Incidental Mutation 'R0069:Zswim6'
ID33120
Institutional Source Beutler Lab
Gene Symbol Zswim6
Ensembl Gene ENSMUSG00000032846
Gene Namezinc finger SWIM-type containing 6
Synonyms2900036G02Rik
MMRRC Submission 038360-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R0069 (G1)
Quality Score225
Status Validated (trace)
Chromosome13
Chromosomal Location107724618-107890064 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to C at 107738563 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105097
SMART Domains Protein: ENSMUSP00000100724
Gene: ENSMUSG00000032846

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 43 71 N/A INTRINSIC
low complexity region 132 193 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225197
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225822
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency 96% (52/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, decreased striatal volume, abnormal medium spiny neuron morphology, and altered motor control including hyperactivity, impaired rotarod performance, repetitive movements, and behavioral hyperresponsiveness to amphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,561,562 C632S probably damaging Het
Antxr2 T A 5: 97,948,250 M392L possibly damaging Het
Cd101 A G 3: 101,008,217 V678A probably benign Het
Clec2g T A 6: 128,948,753 S42T probably benign Het
Clec2g T C 6: 128,980,311 probably null Het
Creb1 A G 1: 64,576,208 I240V possibly damaging Het
D2hgdh G T 1: 93,835,287 V265L possibly damaging Het
Dctn2 A T 10: 127,277,485 probably null Het
Diablo A T 5: 123,518,024 S117R probably damaging Het
Ebf2 A T 14: 67,410,050 R349S probably damaging Het
Fam168a C T 7: 100,835,411 A252V probably benign Het
Fbn2 T C 18: 58,069,184 Y1299C probably damaging Het
Gne A C 4: 44,060,099 V98G probably damaging Het
Hk2 A G 6: 82,736,528 probably null Het
Ifi206 A T 1: 173,486,847 V9D probably damaging Het
Ints3 A G 3: 90,400,647 probably benign Het
Itgal A G 7: 127,310,331 T56A probably benign Het
Lzts3 T A 2: 130,636,540 T213S probably benign Het
Map1b A G 13: 99,429,848 S2122P unknown Het
Mei4 C T 9: 82,025,582 Q223* probably null Het
Mpzl3 T C 9: 45,068,252 V167A probably damaging Het
Myo1d A G 11: 80,637,953 I681T probably damaging Het
Myom2 A G 8: 15,117,624 T1070A probably benign Het
Nacc1 T A 8: 84,677,199 I16F probably damaging Het
Nfx1 T C 4: 40,986,688 probably benign Het
Olfr1335 A T 4: 118,809,690 V58D probably damaging Het
Olfr952 A G 9: 39,426,892 Y60H probably damaging Het
Ostm1 A C 10: 42,692,956 D37A probably benign Het
Pde8a T C 7: 81,319,123 probably benign Het
Pole2 A T 12: 69,209,887 V288E probably damaging Het
Poteg T C 8: 27,447,821 S2P probably benign Het
Ppp2r5c A T 12: 110,567,770 M356L probably benign Het
Prkdc G A 16: 15,726,504 S1786N probably benign Het
Prox1 A G 1: 190,160,919 V443A possibly damaging Het
Prpf6 T A 2: 181,615,963 probably null Het
Ptger1 A T 8: 83,668,319 T142S possibly damaging Het
Rad54l2 C A 9: 106,710,365 V734L possibly damaging Het
Rnpepl1 T A 1: 92,918,898 N507K possibly damaging Het
Slc38a10 A T 11: 120,106,502 V722E probably damaging Het
Slfn10-ps A G 11: 83,035,542 noncoding transcript Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Sult1e1 A T 5: 87,579,897 H175Q probably damaging Het
Ube2e3 C A 2: 78,919,949 probably benign Het
Vmn1r208 A T 13: 22,772,425 W301R probably benign Het
Vps13d A G 4: 145,062,563 I746T probably benign Het
Xpnpep3 T C 15: 81,430,798 V233A probably benign Het
Zfp329 A T 7: 12,810,932 S222T probably damaging Het
Other mutations in Zswim6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01670:Zswim6 APN 13 107728566 splice site noncoding transcript
IGL02367:Zswim6 APN 13 107744102 exon noncoding transcript
IGL02622:Zswim6 APN 13 107748251 exon noncoding transcript
IGL03000:Zswim6 APN 13 107727114 exon noncoding transcript
IGL03000:Zswim6 APN 13 107727115 exon noncoding transcript
R0069:Zswim6 UTSW 13 107738563 exon noncoding transcript
R0834:Zswim6 UTSW 13 107726454 exon noncoding transcript
R1080:Zswim6 UTSW 13 107787651 critical splice donor site noncoding transcript
R1542:Zswim6 UTSW 13 107727234 exon noncoding transcript
R2081:Zswim6 UTSW 13 107773395 exon noncoding transcript
R2133:Zswim6 UTSW 13 107743987 exon noncoding transcript
R3692:Zswim6 UTSW 13 107726541 exon noncoding transcript
R4323:Zswim6 UTSW 13 107889403 exon noncoding transcript
R4345:Zswim6 UTSW 13 107726931 exon noncoding transcript
R4369:Zswim6 UTSW 13 107726694 exon noncoding transcript
R5049:Zswim6 UTSW 13 107726575 exon noncoding transcript
R5111:Zswim6 UTSW 13 107728635 exon noncoding transcript
R5174:Zswim6 UTSW 13 107726681 exon noncoding transcript
R5531:Zswim6 UTSW 13 107769593 exon noncoding transcript
R5933:Zswim6 UTSW 13 107744107 exon noncoding transcript
R5934:Zswim6 UTSW 13 107744107 exon noncoding transcript
R6063:Zswim6 UTSW 13 107728577 exon noncoding transcript
R6168:Zswim6 UTSW 13 107787764 exon noncoding transcript
X0022:Zswim6 UTSW 13 107730324 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- AGCAAGTGACCTGATTTCAAACAAGCTA -3'
(R):5'- TTCTCAGAGTTAAGAGAATTCAGGCCCT -3'

Sequencing Primer
(F):5'- CCTTCTAATAGGAAGACTGCTTGC -3'
(R):5'- GACAACATGGGACAATGCAAGTC -3'
Posted On2013-05-09