Mutagenetix > Incidental Mutation

Incidental Mutation 'R0069:Zswim6'

33120

Institutional Source

Beutler Lab

Gene Symbol

Zswim6

Ensembl Gene

ENSMUSG00000032846

Gene Name

zinc finger SWIM-type containing 6

Synonyms

2900036G02Rik

MMRRC Submission

038360-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.436) question?

Stock #

R0069 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

107861152-108026598 bp(-) (GRCm39)

Type of Mutation

exon

DNA Base Change (assembly)

T to C at 107875098 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000105097

SMART Domains

Protein: ENSMUSP00000100724
Gene: ENSMUSG00000032846

Domain	Start	End	E-Value	Type
low complexity region	19	39	N/A	INTRINSIC
low complexity region	43	71	N/A	INTRINSIC
low complexity region	132	193	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224719

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225197

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225822

Meta Mutation Damage Score

0.1804

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.2%
20x: 95.4%

Validation Efficiency

96% (52/54)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, decreased striatal volume, abnormal medium spiny neuron morphology, and altered motor control including hyperactivity, impaired rotarod performance, repetitive movements, and behavioral hyperresponsiveness to amphetamine. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	A	T	6: 128,538,525 (GRCm39)	C632S	probably damaging	Het
Antxr2	T	A	5: 98,096,109 (GRCm39)	M392L	possibly damaging	Het
Cd101	A	G	3: 100,915,533 (GRCm39)	V678A	probably benign	Het
Clec2g	T	C	6: 128,957,274 (GRCm39)		probably null	Het
Clec2g	T	A	6: 128,925,716 (GRCm39)	S42T	probably benign	Het
Creb1	A	G	1: 64,615,367 (GRCm39)	I240V	possibly damaging	Het
D2hgdh	G	T	1: 93,763,009 (GRCm39)	V265L	possibly damaging	Het
Dctn2	A	T	10: 127,113,354 (GRCm39)		probably null	Het
Diablo	A	T	5: 123,656,087 (GRCm39)	S117R	probably damaging	Het
Ebf2	A	T	14: 67,647,499 (GRCm39)	R349S	probably damaging	Het
Fam168a	C	T	7: 100,484,618 (GRCm39)	A252V	probably benign	Het
Fbn2	T	C	18: 58,202,256 (GRCm39)	Y1299C	probably damaging	Het
Gne	A	C	4: 44,060,099 (GRCm39)	V98G	probably damaging	Het
Hk2	A	G	6: 82,713,509 (GRCm39)		probably null	Het
Ifi206	A	T	1: 173,314,413 (GRCm39)	V9D	probably damaging	Het
Ints3	A	G	3: 90,307,954 (GRCm39)		probably benign	Het
Itgal	A	G	7: 126,909,503 (GRCm39)	T56A	probably benign	Het
Lzts3	T	A	2: 130,478,460 (GRCm39)	T213S	probably benign	Het
Map1b	A	G	13: 99,566,356 (GRCm39)	S2122P	unknown	Het
Mei4	C	T	9: 81,907,635 (GRCm39)	Q223*	probably null	Het
Mpzl3	T	C	9: 44,979,550 (GRCm39)	V167A	probably damaging	Het
Myo1d	A	G	11: 80,528,779 (GRCm39)	I681T	probably damaging	Het
Myom2	A	G	8: 15,167,624 (GRCm39)	T1070A	probably benign	Het
Nacc1	T	A	8: 85,403,828 (GRCm39)	I16F	probably damaging	Het
Nfx1	T	C	4: 40,986,688 (GRCm39)		probably benign	Het
Or10ak12	A	T	4: 118,666,887 (GRCm39)	V58D	probably damaging	Het
Or8g33	A	G	9: 39,338,188 (GRCm39)	Y60H	probably damaging	Het
Ostm1	A	C	10: 42,568,952 (GRCm39)	D37A	probably benign	Het
Pde8a	T	C	7: 80,968,871 (GRCm39)		probably benign	Het
Pole2	A	T	12: 69,256,661 (GRCm39)	V288E	probably damaging	Het
Poteg	T	C	8: 27,937,849 (GRCm39)	S2P	probably benign	Het
Ppp2r5c	A	T	12: 110,534,204 (GRCm39)	M356L	probably benign	Het
Prkdc	G	A	16: 15,544,368 (GRCm39)	S1786N	probably benign	Het
Prox1	A	G	1: 189,893,116 (GRCm39)	V443A	possibly damaging	Het
Prpf6	T	A	2: 181,257,756 (GRCm39)		probably null	Het
Ptger1	A	T	8: 84,394,948 (GRCm39)	T142S	possibly damaging	Het
Rad54l2	C	A	9: 106,587,564 (GRCm39)	V734L	possibly damaging	Het
Rnpepl1	T	A	1: 92,846,620 (GRCm39)	N507K	possibly damaging	Het
Slc38a10	A	T	11: 119,997,328 (GRCm39)	V722E	probably damaging	Het
Slfn10-ps	A	G	11: 82,926,368 (GRCm39)		noncoding transcript	Het
Slitrk6	A	T	14: 110,987,364 (GRCm39)	L781H	probably damaging	Het
Sult1e1	A	T	5: 87,727,756 (GRCm39)	H175Q	probably damaging	Het
Ube2e3	C	A	2: 78,750,293 (GRCm39)		probably benign	Het
Vmn1r208	A	T	13: 22,956,595 (GRCm39)	W301R	probably benign	Het
Vps13d	A	G	4: 144,789,133 (GRCm39)	I746T	probably benign	Het
Xpnpep3	T	C	15: 81,314,999 (GRCm39)	V233A	probably benign	Het
Zfp329	A	T	7: 12,544,859 (GRCm39)	S222T	probably damaging	Het

Other mutations in Zswim6

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL01670:Zswim6	APN	13	107,865,101 (GRCm39)	splice site	noncoding transcript
IGL02367:Zswim6	APN	13	107,880,637 (GRCm39)	exon	noncoding transcript
IGL02622:Zswim6	APN	13	107,884,786 (GRCm39)	exon	noncoding transcript
IGL03000:Zswim6	APN	13	107,863,650 (GRCm39)	exon	noncoding transcript
IGL03000:Zswim6	APN	13	107,863,649 (GRCm39)	exon	noncoding transcript
R0069:Zswim6	UTSW	13	107,875,098 (GRCm39)	exon	noncoding transcript
R0834:Zswim6	UTSW	13	107,862,989 (GRCm39)	exon	noncoding transcript
R1080:Zswim6	UTSW	13	107,924,186 (GRCm39)	critical splice donor site	noncoding transcript
R1542:Zswim6	UTSW	13	107,863,769 (GRCm39)	exon	noncoding transcript
R2081:Zswim6	UTSW	13	107,909,930 (GRCm39)	exon	noncoding transcript
R2133:Zswim6	UTSW	13	107,880,522 (GRCm39)	exon	noncoding transcript
R3692:Zswim6	UTSW	13	107,863,076 (GRCm39)	exon	noncoding transcript
R4323:Zswim6	UTSW	13	108,025,938 (GRCm39)	exon	noncoding transcript
R4345:Zswim6	UTSW	13	107,863,466 (GRCm39)	exon	noncoding transcript
R4369:Zswim6	UTSW	13	107,863,229 (GRCm39)	exon	noncoding transcript
R5049:Zswim6	UTSW	13	107,863,110 (GRCm39)	exon	noncoding transcript
R5111:Zswim6	UTSW	13	107,865,170 (GRCm39)	exon	noncoding transcript
R5174:Zswim6	UTSW	13	107,863,216 (GRCm39)	exon	noncoding transcript
R5531:Zswim6	UTSW	13	107,906,128 (GRCm39)	exon	noncoding transcript
R5933:Zswim6	UTSW	13	107,880,642 (GRCm39)	exon	noncoding transcript
R5934:Zswim6	UTSW	13	107,880,642 (GRCm39)	exon	noncoding transcript
R6063:Zswim6	UTSW	13	107,865,112 (GRCm39)	exon	noncoding transcript
R6168:Zswim6	UTSW	13	107,924,299 (GRCm39)	exon	noncoding transcript
X0022:Zswim6	UTSW	13	107,866,859 (GRCm39)	exon	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- AGCAAGTGACCTGATTTCAAACAAGCTA -3'
(R):5'- TTCTCAGAGTTAAGAGAATTCAGGCCCT -3'

Sequencing Primer
(F):5'- CCTTCTAATAGGAAGACTGCTTGC -3'
(R):5'- GACAACATGGGACAATGCAAGTC -3'

Posted On

2013-05-09