Incidental Mutation 'R0069:Zswim6'
ID 33120
Institutional Source Beutler Lab
Gene Symbol Zswim6
Ensembl Gene ENSMUSG00000032846
Gene Name zinc finger SWIM-type containing 6
Synonyms 2900036G02Rik
MMRRC Submission 038360-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.405) question?
Stock # R0069 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 13
Chromosomal Location 107861152-108026598 bp(-) (GRCm39)
Type of Mutation exon
DNA Base Change (assembly) T to C at 107875098 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105097
SMART Domains Protein: ENSMUSP00000100724
Gene: ENSMUSG00000032846

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 43 71 N/A INTRINSIC
low complexity region 132 193 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225197
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225822
Meta Mutation Damage Score 0.1804 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency 96% (52/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, decreased striatal volume, abnormal medium spiny neuron morphology, and altered motor control including hyperactivity, impaired rotarod performance, repetitive movements, and behavioral hyperresponsiveness to amphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,538,525 (GRCm39) C632S probably damaging Het
Antxr2 T A 5: 98,096,109 (GRCm39) M392L possibly damaging Het
Cd101 A G 3: 100,915,533 (GRCm39) V678A probably benign Het
Clec2g T C 6: 128,957,274 (GRCm39) probably null Het
Clec2g T A 6: 128,925,716 (GRCm39) S42T probably benign Het
Creb1 A G 1: 64,615,367 (GRCm39) I240V possibly damaging Het
D2hgdh G T 1: 93,763,009 (GRCm39) V265L possibly damaging Het
Dctn2 A T 10: 127,113,354 (GRCm39) probably null Het
Diablo A T 5: 123,656,087 (GRCm39) S117R probably damaging Het
Ebf2 A T 14: 67,647,499 (GRCm39) R349S probably damaging Het
Fam168a C T 7: 100,484,618 (GRCm39) A252V probably benign Het
Fbn2 T C 18: 58,202,256 (GRCm39) Y1299C probably damaging Het
Gne A C 4: 44,060,099 (GRCm39) V98G probably damaging Het
Hk2 A G 6: 82,713,509 (GRCm39) probably null Het
Ifi206 A T 1: 173,314,413 (GRCm39) V9D probably damaging Het
Ints3 A G 3: 90,307,954 (GRCm39) probably benign Het
Itgal A G 7: 126,909,503 (GRCm39) T56A probably benign Het
Lzts3 T A 2: 130,478,460 (GRCm39) T213S probably benign Het
Map1b A G 13: 99,566,356 (GRCm39) S2122P unknown Het
Mei4 C T 9: 81,907,635 (GRCm39) Q223* probably null Het
Mpzl3 T C 9: 44,979,550 (GRCm39) V167A probably damaging Het
Myo1d A G 11: 80,528,779 (GRCm39) I681T probably damaging Het
Myom2 A G 8: 15,167,624 (GRCm39) T1070A probably benign Het
Nacc1 T A 8: 85,403,828 (GRCm39) I16F probably damaging Het
Nfx1 T C 4: 40,986,688 (GRCm39) probably benign Het
Or10ak12 A T 4: 118,666,887 (GRCm39) V58D probably damaging Het
Or8g33 A G 9: 39,338,188 (GRCm39) Y60H probably damaging Het
Ostm1 A C 10: 42,568,952 (GRCm39) D37A probably benign Het
Pde8a T C 7: 80,968,871 (GRCm39) probably benign Het
Pole2 A T 12: 69,256,661 (GRCm39) V288E probably damaging Het
Poteg T C 8: 27,937,849 (GRCm39) S2P probably benign Het
Ppp2r5c A T 12: 110,534,204 (GRCm39) M356L probably benign Het
Prkdc G A 16: 15,544,368 (GRCm39) S1786N probably benign Het
Prox1 A G 1: 189,893,116 (GRCm39) V443A possibly damaging Het
Prpf6 T A 2: 181,257,756 (GRCm39) probably null Het
Ptger1 A T 8: 84,394,948 (GRCm39) T142S possibly damaging Het
Rad54l2 C A 9: 106,587,564 (GRCm39) V734L possibly damaging Het
Rnpepl1 T A 1: 92,846,620 (GRCm39) N507K possibly damaging Het
Slc38a10 A T 11: 119,997,328 (GRCm39) V722E probably damaging Het
Slfn10-ps A G 11: 82,926,368 (GRCm39) noncoding transcript Het
Slitrk6 A T 14: 110,987,364 (GRCm39) L781H probably damaging Het
Sult1e1 A T 5: 87,727,756 (GRCm39) H175Q probably damaging Het
Ube2e3 C A 2: 78,750,293 (GRCm39) probably benign Het
Vmn1r208 A T 13: 22,956,595 (GRCm39) W301R probably benign Het
Vps13d A G 4: 144,789,133 (GRCm39) I746T probably benign Het
Xpnpep3 T C 15: 81,314,999 (GRCm39) V233A probably benign Het
Zfp329 A T 7: 12,544,859 (GRCm39) S222T probably damaging Het
Other mutations in Zswim6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01670:Zswim6 APN 13 107,865,101 (GRCm39) splice site noncoding transcript
IGL02367:Zswim6 APN 13 107,880,637 (GRCm39) exon noncoding transcript
IGL02622:Zswim6 APN 13 107,884,786 (GRCm39) exon noncoding transcript
IGL03000:Zswim6 APN 13 107,863,650 (GRCm39) exon noncoding transcript
IGL03000:Zswim6 APN 13 107,863,649 (GRCm39) exon noncoding transcript
R0069:Zswim6 UTSW 13 107,875,098 (GRCm39) exon noncoding transcript
R0834:Zswim6 UTSW 13 107,862,989 (GRCm39) exon noncoding transcript
R1080:Zswim6 UTSW 13 107,924,186 (GRCm39) critical splice donor site noncoding transcript
R1542:Zswim6 UTSW 13 107,863,769 (GRCm39) exon noncoding transcript
R2081:Zswim6 UTSW 13 107,909,930 (GRCm39) exon noncoding transcript
R2133:Zswim6 UTSW 13 107,880,522 (GRCm39) exon noncoding transcript
R3692:Zswim6 UTSW 13 107,863,076 (GRCm39) exon noncoding transcript
R4323:Zswim6 UTSW 13 108,025,938 (GRCm39) exon noncoding transcript
R4345:Zswim6 UTSW 13 107,863,466 (GRCm39) exon noncoding transcript
R4369:Zswim6 UTSW 13 107,863,229 (GRCm39) exon noncoding transcript
R5049:Zswim6 UTSW 13 107,863,110 (GRCm39) exon noncoding transcript
R5111:Zswim6 UTSW 13 107,865,170 (GRCm39) exon noncoding transcript
R5174:Zswim6 UTSW 13 107,863,216 (GRCm39) exon noncoding transcript
R5531:Zswim6 UTSW 13 107,906,128 (GRCm39) exon noncoding transcript
R5933:Zswim6 UTSW 13 107,880,642 (GRCm39) exon noncoding transcript
R5934:Zswim6 UTSW 13 107,880,642 (GRCm39) exon noncoding transcript
R6063:Zswim6 UTSW 13 107,865,112 (GRCm39) exon noncoding transcript
R6168:Zswim6 UTSW 13 107,924,299 (GRCm39) exon noncoding transcript
X0022:Zswim6 UTSW 13 107,866,859 (GRCm39) exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- AGCAAGTGACCTGATTTCAAACAAGCTA -3'
(R):5'- TTCTCAGAGTTAAGAGAATTCAGGCCCT -3'

Sequencing Primer
(F):5'- CCTTCTAATAGGAAGACTGCTTGC -3'
(R):5'- GACAACATGGGACAATGCAAGTC -3'
Posted On 2013-05-09