Incidental Mutation 'R0069:Ebf2'
ID33122
Institutional Source Beutler Lab
Gene Symbol Ebf2
Ensembl Gene ENSMUSG00000022053
Gene Nameearly B cell factor 2
SynonymsMmot1, D14Ggc1e, O/E-3
MMRRC Submission 038360-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.854) question?
Stock #R0069 (G1)
Quality Score225
Status Validated (trace)
Chromosome14
Chromosomal Location67233292-67430918 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67410050 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 349 (R349S)
Ref Sequence ENSEMBL: ENSMUSP00000135500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022637] [ENSMUST00000176029] [ENSMUST00000176161]
Predicted Effect probably damaging
Transcript: ENSMUST00000022637
AA Change: R349S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022637
Gene: ENSMUSG00000022053
AA Change: R349S

DomainStartEndE-ValueType
IPT 252 336 9.09e-8 SMART
HLH 337 386 3.39e-1 SMART
internal_repeat_1 388 412 2.68e-6 PROSPERO
low complexity region 454 484 N/A INTRINSIC
low complexity region 512 531 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176029
AA Change: R349S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135782
Gene: ENSMUSG00000022053
AA Change: R349S

DomainStartEndE-ValueType
Pfam:COE1_DBD 16 246 2.3e-145 PFAM
IPT 252 336 9.09e-8 SMART
HLH 337 386 3.39e-1 SMART
internal_repeat_1 388 412 2.68e-6 PROSPERO
low complexity region 454 484 N/A INTRINSIC
low complexity region 512 531 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176161
AA Change: R349S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135500
Gene: ENSMUSG00000022053
AA Change: R349S

DomainStartEndE-ValueType
IPT 252 336 9.09e-8 SMART
HLH 337 386 3.39e-1 SMART
internal_repeat_1 388 412 2.68e-6 PROSPERO
low complexity region 454 484 N/A INTRINSIC
low complexity region 512 531 N/A INTRINSIC
Meta Mutation Damage Score 0.24 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the COE (Collier/Olf/EBF) family of non-basic, helix-loop-helix transcription factors that have a well conserved DNA binding domain. The COE family proteins play an important role in variety of developmental processes. Studies in mouse suggest that this gene may be involved in the differentiation of osteoblasts. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mutants show decreased viability, impaired olfactory neuron projection, and impaired mating, more so in male mice. Mice homozygous for another knock-out allele exhibit narcolepsy-cataplexy syndrome and decreased orexinergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,561,562 C632S probably damaging Het
Antxr2 T A 5: 97,948,250 M392L possibly damaging Het
Cd101 A G 3: 101,008,217 V678A probably benign Het
Clec2g T A 6: 128,948,753 S42T probably benign Het
Clec2g T C 6: 128,980,311 probably null Het
Creb1 A G 1: 64,576,208 I240V possibly damaging Het
D2hgdh G T 1: 93,835,287 V265L possibly damaging Het
Dctn2 A T 10: 127,277,485 probably null Het
Diablo A T 5: 123,518,024 S117R probably damaging Het
Fam168a C T 7: 100,835,411 A252V probably benign Het
Fbn2 T C 18: 58,069,184 Y1299C probably damaging Het
Gne A C 4: 44,060,099 V98G probably damaging Het
Hk2 A G 6: 82,736,528 probably null Het
Ifi206 A T 1: 173,486,847 V9D probably damaging Het
Ints3 A G 3: 90,400,647 probably benign Het
Itgal A G 7: 127,310,331 T56A probably benign Het
Lzts3 T A 2: 130,636,540 T213S probably benign Het
Map1b A G 13: 99,429,848 S2122P unknown Het
Mei4 C T 9: 82,025,582 Q223* probably null Het
Mpzl3 T C 9: 45,068,252 V167A probably damaging Het
Myo1d A G 11: 80,637,953 I681T probably damaging Het
Myom2 A G 8: 15,117,624 T1070A probably benign Het
Nacc1 T A 8: 84,677,199 I16F probably damaging Het
Nfx1 T C 4: 40,986,688 probably benign Het
Olfr1335 A T 4: 118,809,690 V58D probably damaging Het
Olfr952 A G 9: 39,426,892 Y60H probably damaging Het
Ostm1 A C 10: 42,692,956 D37A probably benign Het
Pde8a T C 7: 81,319,123 probably benign Het
Pole2 A T 12: 69,209,887 V288E probably damaging Het
Poteg T C 8: 27,447,821 S2P probably benign Het
Ppp2r5c A T 12: 110,567,770 M356L probably benign Het
Prkdc G A 16: 15,726,504 S1786N probably benign Het
Prox1 A G 1: 190,160,919 V443A possibly damaging Het
Prpf6 T A 2: 181,615,963 probably null Het
Ptger1 A T 8: 83,668,319 T142S possibly damaging Het
Rad54l2 C A 9: 106,710,365 V734L possibly damaging Het
Rnpepl1 T A 1: 92,918,898 N507K possibly damaging Het
Slc38a10 A T 11: 120,106,502 V722E probably damaging Het
Slfn10-ps A G 11: 83,035,542 noncoding transcript Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Sult1e1 A T 5: 87,579,897 H175Q probably damaging Het
Ube2e3 C A 2: 78,919,949 probably benign Het
Vmn1r208 A T 13: 22,772,425 W301R probably benign Het
Vps13d A G 4: 145,062,563 I746T probably benign Het
Xpnpep3 T C 15: 81,430,798 V233A probably benign Het
Zfp329 A T 7: 12,810,932 S222T probably damaging Het
Zswim6 T C 13: 107,738,563 noncoding transcript Het
Other mutations in Ebf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Ebf2 APN 14 67239478 missense probably damaging 1.00
IGL01808:Ebf2 APN 14 67414483 missense probably benign 0.01
IGL02087:Ebf2 APN 14 67428096 missense probably benign 0.03
IGL02094:Ebf2 APN 14 67235240 missense possibly damaging 0.80
IGL02270:Ebf2 APN 14 67238953 missense probably damaging 1.00
IGL03222:Ebf2 APN 14 67411992 splice site probably null
IGL03390:Ebf2 APN 14 67424109 missense probably benign 0.19
R0044:Ebf2 UTSW 14 67310968 intron probably benign
R0062:Ebf2 UTSW 14 67238540 splice site probably benign
R0062:Ebf2 UTSW 14 67238540 splice site probably benign
R0069:Ebf2 UTSW 14 67410050 missense probably damaging 0.99
R0505:Ebf2 UTSW 14 67371736 nonsense probably null
R2103:Ebf2 UTSW 14 67387942 missense probably damaging 1.00
R2438:Ebf2 UTSW 14 67387942 missense probably damaging 1.00
R3789:Ebf2 UTSW 14 67239493 critical splice donor site probably null
R4153:Ebf2 UTSW 14 67235223 missense probably damaging 1.00
R4348:Ebf2 UTSW 14 67239422 missense probably damaging 0.99
R4793:Ebf2 UTSW 14 67410082 missense probably damaging 1.00
R4991:Ebf2 UTSW 14 67389657 missense possibly damaging 0.87
R5164:Ebf2 UTSW 14 67390521 missense possibly damaging 0.94
R5222:Ebf2 UTSW 14 67313594 intron probably benign
R5227:Ebf2 UTSW 14 67247069 missense probably damaging 0.99
R5459:Ebf2 UTSW 14 67235201 missense probably benign 0.34
R5622:Ebf2 UTSW 14 67390558 missense possibly damaging 0.91
R6035:Ebf2 UTSW 14 67238974 missense probably damaging 1.00
R6035:Ebf2 UTSW 14 67238974 missense probably damaging 1.00
R6265:Ebf2 UTSW 14 67424060 missense probably benign 0.00
R6893:Ebf2 UTSW 14 67237559 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TGGTAGATGGAGACTTACCACACATCC -3'
(R):5'- TGCCTGAATATTGGTGAACTTCAGCAG -3'

Sequencing Primer
(F):5'- GTGTGAATTAACCAATGTCAACAAC -3'
(R):5'- ggaggcaaaggcaggtag -3'
Posted On2013-05-09