Incidental Mutation 'R4510:Fgfr4'
ID331225
Institutional Source Beutler Lab
Gene Symbol Fgfr4
Ensembl Gene ENSMUSG00000005320
Gene Namefibroblast growth factor receptor 4
SynonymsFgfr-4
MMRRC Submission 041585-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4510 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location55152640-55168759 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 55161515 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 455 (P455Q)
Ref Sequence ENSEMBL: ENSMUSP00000005452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005452]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005452
AA Change: P455Q

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000005452
Gene: ENSMUSG00000005320
AA Change: P455Q

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IGc2 45 105 1.39e-11 SMART
IGc2 160 228 3.1e-18 SMART
IGc2 259 337 1.59e-6 SMART
low complexity region 369 387 N/A INTRINSIC
low complexity region 416 446 N/A INTRINSIC
TyrKc 464 740 1.67e-148 SMART
low complexity region 764 795 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162967
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. The genomic organization of this gene, compared to members 1-3, encompasses 18 exons rather than 19 or 20. Although alternative splicing has been observed, there is no evidence that the C-terminal half of the IgIII domain of this protein varies between three alternate forms, as indicated for members 1-3. This particular family member preferentially binds acidic fibroblast growth factor and, although its specific function is unknown, it is overexpressed in gynecological tumor samples, suggesting a role in breast and ovarian tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted mutation are viable, healthy and overtly normal, except for a 10% weight reduction at weaning. Mice doubly homozygous for disruptions of Fgfr3 and Fgfr4 show novel phenotypes not seen in either single mutant, including dwarfismand defective respiratory alveogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,277,328 S1530P possibly damaging Het
9330159F19Rik T A 10: 29,224,823 D397E probably benign Het
Abcc10 A G 17: 46,307,210 F1005L probably damaging Het
Ackr4 T C 9: 104,098,731 E339G probably benign Het
Adam39 G T 8: 40,826,291 C573F probably damaging Het
Anks1b A G 10: 90,510,790 T651A probably benign Het
Aoc1 C A 6: 48,907,806 H594Q probably damaging Het
Arid1a A C 4: 133,695,699 probably benign Het
Atp4a G T 7: 30,724,253 E928* probably null Het
Atp5j T C 16: 84,827,974 D104G probably benign Het
Atp8b5 A G 4: 43,320,629 T206A probably damaging Het
Atrn G A 2: 130,935,577 W182* probably null Het
BC017158 A T 7: 128,276,140 F319Y probably damaging Het
Cacna1e G A 1: 154,561,833 T257I probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Crebrf A G 17: 26,742,964 Y345C probably benign Het
Cyp26b1 G A 6: 84,574,491 R248W probably damaging Het
Dclk3 C A 9: 111,467,992 H201Q probably benign Het
Ddx17 A T 15: 79,538,592 V315E probably damaging Het
Dhrs11 T C 11: 84,825,516 *51W probably null Het
Gabbr1 A G 17: 37,069,211 K697E probably damaging Het
Gcnt1 G A 19: 17,330,277 T28I probably benign Het
Gga2 G A 7: 122,021,078 T4M unknown Het
Gm12185 T A 11: 48,908,478 H396L possibly damaging Het
Gm12794 A T 4: 101,941,560 M243L probably benign Het
Gm21976 A G 13: 98,305,331 R123G probably benign Het
Hecw1 A C 13: 14,357,191 V166G probably damaging Het
Hpx A G 7: 105,592,088 V372A possibly damaging Het
Igkv2-109 A G 6: 68,302,978 Y61C probably damaging Het
Igsf1 A G X: 49,786,173 F789S probably damaging Het
Il4ra A G 7: 125,576,108 D496G possibly damaging Het
Ilf3 A G 9: 21,399,215 T547A possibly damaging Het
Insrr C A 3: 87,808,671 P558T possibly damaging Het
Ints9 A G 14: 65,028,932 D411G possibly damaging Het
Irak3 T A 10: 120,145,908 H393L probably damaging Het
Isx G A 8: 74,873,670 M10I probably benign Het
Itga11 A G 9: 62,761,588 D709G probably damaging Het
Kcng2 G T 18: 80,295,715 R453S probably benign Het
Kif5b A G 18: 6,214,011 V664A probably benign Het
Lalba A G 15: 98,482,541 L44P probably benign Het
Ldlrad1 T G 4: 107,209,518 F17V probably benign Het
Lnx1 C T 5: 74,620,192 D382N probably damaging Het
Lrp1 T C 10: 127,593,848 Y451C probably damaging Het
Lrp2 A T 2: 69,480,062 N2722K possibly damaging Het
Mctp1 G A 13: 76,825,272 V431I probably benign Het
Mmrn2 T C 14: 34,403,059 F866L possibly damaging Het
Mylk2 A G 2: 152,917,410 E367G probably damaging Het
Nfatc1 A G 18: 80,635,579 S865P probably damaging Het
Nol6 G C 4: 41,123,526 T74R probably damaging Het
Notch2 T C 3: 98,146,321 M2100T probably benign Het
Parp1 A G 1: 180,591,276 K667R possibly damaging Het
Phlda3 A G 1: 135,766,662 T72A probably damaging Het
Polg T C 7: 79,455,522 Q758R probably benign Het
Polq G A 16: 37,048,563 R765H probably damaging Het
Prkd1 T C 12: 50,392,979 D355G possibly damaging Het
Prpf8 T C 11: 75,491,826 Y398H probably damaging Het
Ripk1 T C 13: 34,026,748 Y309H probably damaging Het
Rngtt A T 4: 33,339,032 Q279L possibly damaging Het
Samd4 T A 14: 47,077,585 V114D probably benign Het
Sec23ip G A 7: 128,779,176 E956K probably damaging Het
Slc4a1ap A T 5: 31,527,403 T128S probably benign Het
Slc5a11 A T 7: 123,235,635 I6F probably benign Het
Slc6a19 A C 13: 73,683,975 L494R probably damaging Het
Slc6a21 A G 7: 45,287,289 D189G probably damaging Het
Slc7a1 G T 5: 148,340,562 A381D probably damaging Het
Smc4 T A 3: 69,016,647 probably null Het
Stk19 T C 17: 34,832,528 E17G probably damaging Het
Tekt5 A C 16: 10,358,013 V556G probably benign Het
Tenm4 T C 7: 96,894,863 F2029L probably benign Het
Thnsl1 T C 2: 21,212,425 V330A probably damaging Het
Tnfrsf21 A G 17: 43,065,019 D432G probably damaging Het
Tnip1 T A 11: 54,926,790 S244C probably benign Het
Tnrc6c A T 11: 117,742,958 N1294I possibly damaging Het
Trpm3 A G 19: 22,988,017 I1625M probably benign Het
Ttn A T 2: 76,745,429 V25040E probably damaging Het
Vwa5a A G 9: 38,722,557 N19D possibly damaging Het
Washc2 A T 6: 116,220,556 D250V probably damaging Het
Xpo1 A G 11: 23,287,401 T755A possibly damaging Het
Zfp462 C T 4: 55,008,934 T300I possibly damaging Het
Zfp937 A C 2: 150,238,511 T154P probably damaging Het
Zzef1 A G 11: 72,888,170 D1819G probably benign Het
Other mutations in Fgfr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Fgfr4 APN 13 55159170 missense probably damaging 0.99
IGL02140:Fgfr4 APN 13 55161179 missense probably benign
IGL02817:Fgfr4 APN 13 55156668 critical splice donor site probably null
Modest UTSW 13 55166251 missense probably damaging 1.00
R0153:Fgfr4 UTSW 13 55161385 splice site probably benign
R0727:Fgfr4 UTSW 13 55156228 splice site probably null
R1646:Fgfr4 UTSW 13 55165964 missense probably damaging 1.00
R1749:Fgfr4 UTSW 13 55167792 splice site probably null
R1993:Fgfr4 UTSW 13 55165902 missense probably damaging 1.00
R2037:Fgfr4 UTSW 13 55167889 missense possibly damaging 0.51
R2152:Fgfr4 UTSW 13 55166964 missense probably damaging 1.00
R2386:Fgfr4 UTSW 13 55167901 missense probably benign 0.36
R3086:Fgfr4 UTSW 13 55167392 splice site probably benign
R3939:Fgfr4 UTSW 13 55156494 missense probably null 0.96
R4255:Fgfr4 UTSW 13 55166251 missense probably damaging 1.00
R4463:Fgfr4 UTSW 13 55156467 missense probably benign 0.02
R4511:Fgfr4 UTSW 13 55161515 missense possibly damaging 0.81
R4852:Fgfr4 UTSW 13 55161156 missense possibly damaging 0.68
R4932:Fgfr4 UTSW 13 55168170 missense unknown
R5133:Fgfr4 UTSW 13 55160015 missense probably damaging 1.00
R5146:Fgfr4 UTSW 13 55165912 missense probably damaging 1.00
R5380:Fgfr4 UTSW 13 55167417 missense probably damaging 1.00
R5431:Fgfr4 UTSW 13 55156651 missense probably benign
R5927:Fgfr4 UTSW 13 55166887 missense probably damaging 1.00
R6318:Fgfr4 UTSW 13 55166108 missense probably damaging 1.00
R6792:Fgfr4 UTSW 13 55156898 missense possibly damaging 0.65
R7018:Fgfr4 UTSW 13 55166200 missense probably damaging 0.98
R7290:Fgfr4 UTSW 13 55161449 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATACAAAAGCTGTCCCGTTTCC -3'
(R):5'- ATACCAAAGGCCTCTGCACG -3'

Sequencing Primer
(F):5'- CTTTGGCCCGACAGGTAC -3'
(R):5'- GCCTCTGCACGAACCACTTG -3'
Posted On2015-07-21