Incidental Mutation 'R4510:Mctp1'
ID331226
Institutional Source Beutler Lab
Gene Symbol Mctp1
Ensembl Gene ENSMUSG00000021596
Gene Namemultiple C2 domains, transmembrane 1
Synonyms
MMRRC Submission 041585-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R4510 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location76384535-77031810 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 76825272 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 431 (V431I)
Ref Sequence ENSEMBL: ENSMUSP00000105212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109583] [ENSMUST00000125209]
Predicted Effect probably benign
Transcript: ENSMUST00000109583
AA Change: V431I

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105212
Gene: ENSMUSG00000021596
AA Change: V431I

DomainStartEndE-ValueType
C2 3 100 1.15e-15 SMART
C2 166 263 1.35e-21 SMART
C2 322 418 4.76e-22 SMART
transmembrane domain 513 535 N/A INTRINSIC
Pfam:PRT_C 542 672 3.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122843
Predicted Effect probably benign
Transcript: ENSMUST00000125209
AA Change: V688I

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000118958
Gene: ENSMUSG00000021596
AA Change: V688I

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
low complexity region 49 63 N/A INTRINSIC
low complexity region 134 174 N/A INTRINSIC
low complexity region 211 228 N/A INTRINSIC
C2 260 357 1.15e-15 SMART
C2 423 520 1.35e-21 SMART
C2 579 675 4.76e-22 SMART
transmembrane domain 770 792 N/A INTRINSIC
Pfam:PRT_C 800 929 2.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155275
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,277,328 S1530P possibly damaging Het
9330159F19Rik T A 10: 29,224,823 D397E probably benign Het
Abcc10 A G 17: 46,307,210 F1005L probably damaging Het
Ackr4 T C 9: 104,098,731 E339G probably benign Het
Adam39 G T 8: 40,826,291 C573F probably damaging Het
Anks1b A G 10: 90,510,790 T651A probably benign Het
Aoc1 C A 6: 48,907,806 H594Q probably damaging Het
Arid1a A C 4: 133,695,699 probably benign Het
Atp4a G T 7: 30,724,253 E928* probably null Het
Atp5j T C 16: 84,827,974 D104G probably benign Het
Atp8b5 A G 4: 43,320,629 T206A probably damaging Het
Atrn G A 2: 130,935,577 W182* probably null Het
BC017158 A T 7: 128,276,140 F319Y probably damaging Het
Cacna1e G A 1: 154,561,833 T257I probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Crebrf A G 17: 26,742,964 Y345C probably benign Het
Cyp26b1 G A 6: 84,574,491 R248W probably damaging Het
Dclk3 C A 9: 111,467,992 H201Q probably benign Het
Ddx17 A T 15: 79,538,592 V315E probably damaging Het
Dhrs11 T C 11: 84,825,516 *51W probably null Het
Fgfr4 C A 13: 55,161,515 P455Q possibly damaging Het
Gabbr1 A G 17: 37,069,211 K697E probably damaging Het
Gcnt1 G A 19: 17,330,277 T28I probably benign Het
Gga2 G A 7: 122,021,078 T4M unknown Het
Gm12185 T A 11: 48,908,478 H396L possibly damaging Het
Gm12794 A T 4: 101,941,560 M243L probably benign Het
Gm21976 A G 13: 98,305,331 R123G probably benign Het
Hecw1 A C 13: 14,357,191 V166G probably damaging Het
Hpx A G 7: 105,592,088 V372A possibly damaging Het
Igkv2-109 A G 6: 68,302,978 Y61C probably damaging Het
Igsf1 A G X: 49,786,173 F789S probably damaging Het
Il4ra A G 7: 125,576,108 D496G possibly damaging Het
Ilf3 A G 9: 21,399,215 T547A possibly damaging Het
Insrr C A 3: 87,808,671 P558T possibly damaging Het
Ints9 A G 14: 65,028,932 D411G possibly damaging Het
Irak3 T A 10: 120,145,908 H393L probably damaging Het
Isx G A 8: 74,873,670 M10I probably benign Het
Itga11 A G 9: 62,761,588 D709G probably damaging Het
Kcng2 G T 18: 80,295,715 R453S probably benign Het
Kif5b A G 18: 6,214,011 V664A probably benign Het
Lalba A G 15: 98,482,541 L44P probably benign Het
Ldlrad1 T G 4: 107,209,518 F17V probably benign Het
Lnx1 C T 5: 74,620,192 D382N probably damaging Het
Lrp1 T C 10: 127,593,848 Y451C probably damaging Het
Lrp2 A T 2: 69,480,062 N2722K possibly damaging Het
Mmrn2 T C 14: 34,403,059 F866L possibly damaging Het
Mylk2 A G 2: 152,917,410 E367G probably damaging Het
Nfatc1 A G 18: 80,635,579 S865P probably damaging Het
Nol6 G C 4: 41,123,526 T74R probably damaging Het
Notch2 T C 3: 98,146,321 M2100T probably benign Het
Parp1 A G 1: 180,591,276 K667R possibly damaging Het
Phlda3 A G 1: 135,766,662 T72A probably damaging Het
Polg T C 7: 79,455,522 Q758R probably benign Het
Polq G A 16: 37,048,563 R765H probably damaging Het
Prkd1 T C 12: 50,392,979 D355G possibly damaging Het
Prpf8 T C 11: 75,491,826 Y398H probably damaging Het
Ripk1 T C 13: 34,026,748 Y309H probably damaging Het
Rngtt A T 4: 33,339,032 Q279L possibly damaging Het
Samd4 T A 14: 47,077,585 V114D probably benign Het
Sec23ip G A 7: 128,779,176 E956K probably damaging Het
Slc4a1ap A T 5: 31,527,403 T128S probably benign Het
Slc5a11 A T 7: 123,235,635 I6F probably benign Het
Slc6a19 A C 13: 73,683,975 L494R probably damaging Het
Slc6a21 A G 7: 45,287,289 D189G probably damaging Het
Slc7a1 G T 5: 148,340,562 A381D probably damaging Het
Smc4 T A 3: 69,016,647 probably null Het
Stk19 T C 17: 34,832,528 E17G probably damaging Het
Tekt5 A C 16: 10,358,013 V556G probably benign Het
Tenm4 T C 7: 96,894,863 F2029L probably benign Het
Thnsl1 T C 2: 21,212,425 V330A probably damaging Het
Tnfrsf21 A G 17: 43,065,019 D432G probably damaging Het
Tnip1 T A 11: 54,926,790 S244C probably benign Het
Tnrc6c A T 11: 117,742,958 N1294I possibly damaging Het
Trpm3 A G 19: 22,988,017 I1625M probably benign Het
Ttn A T 2: 76,745,429 V25040E probably damaging Het
Vwa5a A G 9: 38,722,557 N19D possibly damaging Het
Washc2 A T 6: 116,220,556 D250V probably damaging Het
Xpo1 A G 11: 23,287,401 T755A possibly damaging Het
Zfp462 C T 4: 55,008,934 T300I possibly damaging Het
Zfp937 A C 2: 150,238,511 T154P probably damaging Het
Zzef1 A G 11: 72,888,170 D1819G probably benign Het
Other mutations in Mctp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Mctp1 APN 13 77020798 missense probably damaging 0.98
IGL01355:Mctp1 APN 13 76384955 missense probably benign
IGL02192:Mctp1 APN 13 76731768 intron probably benign
IGL02342:Mctp1 APN 13 77024857 missense probably damaging 1.00
IGL02706:Mctp1 APN 13 76823069 missense probably damaging 1.00
IGL02950:Mctp1 APN 13 77024810 missense probably damaging 1.00
IGL03064:Mctp1 APN 13 76801513 nonsense probably null
IGL03230:Mctp1 APN 13 76824857 missense possibly damaging 0.49
R0138:Mctp1 UTSW 13 76827712 missense probably damaging 1.00
R0355:Mctp1 UTSW 13 76824863 missense probably damaging 1.00
R0383:Mctp1 UTSW 13 76801544 missense probably damaging 1.00
R0426:Mctp1 UTSW 13 77020821 missense probably benign 0.01
R0462:Mctp1 UTSW 13 76801401 missense probably damaging 1.00
R0483:Mctp1 UTSW 13 76827727 missense probably damaging 1.00
R0685:Mctp1 UTSW 13 76825799 critical splice donor site probably null
R1468:Mctp1 UTSW 13 76825273 missense probably benign 0.25
R1468:Mctp1 UTSW 13 76825273 missense probably benign 0.25
R1854:Mctp1 UTSW 13 76825741 missense probably damaging 0.96
R1864:Mctp1 UTSW 13 76385148 missense possibly damaging 0.63
R1865:Mctp1 UTSW 13 76385148 missense possibly damaging 0.63
R1920:Mctp1 UTSW 13 76384610 missense possibly damaging 0.67
R2071:Mctp1 UTSW 13 76759724 missense probably damaging 1.00
R2127:Mctp1 UTSW 13 76824822 missense probably damaging 1.00
R2128:Mctp1 UTSW 13 76824822 missense probably damaging 1.00
R2129:Mctp1 UTSW 13 76824822 missense probably damaging 1.00
R3709:Mctp1 UTSW 13 76824880 splice site probably null
R4463:Mctp1 UTSW 13 76712087 missense probably damaging 1.00
R4511:Mctp1 UTSW 13 76825272 missense probably benign 0.20
R4951:Mctp1 UTSW 13 76827775 missense probably damaging 0.96
R5004:Mctp1 UTSW 13 76641804 missense possibly damaging 0.79
R5307:Mctp1 UTSW 13 76712079 critical splice acceptor site probably null
R5339:Mctp1 UTSW 13 76825706 intron probably benign
R5639:Mctp1 UTSW 13 77024783 splice site silent
R5769:Mctp1 UTSW 13 76759808 missense probably damaging 1.00
R5800:Mctp1 UTSW 13 76688559 missense probably damaging 1.00
R5913:Mctp1 UTSW 13 76759825 splice site probably null
R5981:Mctp1 UTSW 13 76757110 missense probably damaging 1.00
R6024:Mctp1 UTSW 13 76385161 missense probably damaging 0.98
R6192:Mctp1 UTSW 13 76822963 splice site probably null
R6331:Mctp1 UTSW 13 77020863 critical splice donor site probably null
R6468:Mctp1 UTSW 13 76731811 critical splice donor site probably null
R6484:Mctp1 UTSW 13 76688625 missense probably benign 0.02
R6656:Mctp1 UTSW 13 77029936 missense probably damaging 0.99
R7026:Mctp1 UTSW 13 76806259 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- ATGAACAGGTACTTGTCAGAATTGCC -3'
(R):5'- ACAGAAAGTGTGGGTGTGCC -3'

Sequencing Primer
(F):5'- CTTGTCAGAATTGCCACAGTTG -3'
(R):5'- GGTGTGCCAGGCAGTGC -3'
Posted On2015-07-21