Incidental Mutation 'R4510:Gabbr1'
ID331234
Institutional Source Beutler Lab
Gene Symbol Gabbr1
Ensembl Gene ENSMUSG00000024462
Gene Namegamma-aminobutyric acid (GABA) B receptor, 1
SynonymsGABAB1, GABAbR1
MMRRC Submission 041585-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.725) question?
Stock #R4510 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37045966-37075067 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37069211 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 697 (K697E)
Ref Sequence ENSEMBL: ENSMUSP00000025338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025338] [ENSMUST00000172792] [ENSMUST00000173823]
Predicted Effect probably damaging
Transcript: ENSMUST00000025338
AA Change: K697E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025338
Gene: ENSMUSG00000024462
AA Change: K697E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CCP 29 95 8.72e0 SMART
CCP 99 156 3.03e-10 SMART
Pfam:Peripla_BP_6 168 538 1.6e-23 PFAM
Pfam:ANF_receptor 186 542 4.3e-73 PFAM
Pfam:7tm_3 602 858 9.8e-49 PFAM
coiled coil region 877 922 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172792
AA Change: K581E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134268
Gene: ENSMUSG00000024462
AA Change: K581E

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 30 51 N/A INTRINSIC
Pfam:Peripla_BP_6 52 428 7.8e-24 PFAM
Pfam:ANF_receptor 70 426 5.7e-68 PFAM
Pfam:7tm_3 484 743 1.1e-50 PFAM
coiled coil region 761 806 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173823
SMART Domains Protein: ENSMUSP00000133797
Gene: ENSMUSG00000024462

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sushi 29 95 1.6e-6 PFAM
low complexity region 159 176 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174181
Meta Mutation Damage Score 0.198 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for gamma-aminobutyric acid (GABA), which is the main inhibitory neurotransmitter in the mammalian central nervous system. This receptor functions as a heterodimer with GABA(B) receptor 2. Defects in this gene may underlie brain disorders such as schizophrenia and epilepsy. Alternative splicing generates multiple transcript variants, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jan 2016]
PHENOTYPE: Phenotypes of null mice vary depending on strain background and allele. Homozygous null mice may display seizures, premature death, and abnormal nervous system electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,277,328 S1530P possibly damaging Het
9330159F19Rik T A 10: 29,224,823 D397E probably benign Het
Abcc10 A G 17: 46,307,210 F1005L probably damaging Het
Ackr4 T C 9: 104,098,731 E339G probably benign Het
Adam39 G T 8: 40,826,291 C573F probably damaging Het
Anks1b A G 10: 90,510,790 T651A probably benign Het
Aoc1 C A 6: 48,907,806 H594Q probably damaging Het
Arid1a A C 4: 133,695,699 probably benign Het
Atp4a G T 7: 30,724,253 E928* probably null Het
Atp5j T C 16: 84,827,974 D104G probably benign Het
Atp8b5 A G 4: 43,320,629 T206A probably damaging Het
Atrn G A 2: 130,935,577 W182* probably null Het
BC017158 A T 7: 128,276,140 F319Y probably damaging Het
Cacna1e G A 1: 154,561,833 T257I probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Crebrf A G 17: 26,742,964 Y345C probably benign Het
Cyp26b1 G A 6: 84,574,491 R248W probably damaging Het
Dclk3 C A 9: 111,467,992 H201Q probably benign Het
Ddx17 A T 15: 79,538,592 V315E probably damaging Het
Dhrs11 T C 11: 84,825,516 *51W probably null Het
Fgfr4 C A 13: 55,161,515 P455Q possibly damaging Het
Gcnt1 G A 19: 17,330,277 T28I probably benign Het
Gga2 G A 7: 122,021,078 T4M unknown Het
Gm12185 T A 11: 48,908,478 H396L possibly damaging Het
Gm12794 A T 4: 101,941,560 M243L probably benign Het
Gm21976 A G 13: 98,305,331 R123G probably benign Het
Hecw1 A C 13: 14,357,191 V166G probably damaging Het
Hpx A G 7: 105,592,088 V372A possibly damaging Het
Igkv2-109 A G 6: 68,302,978 Y61C probably damaging Het
Igsf1 A G X: 49,786,173 F789S probably damaging Het
Il4ra A G 7: 125,576,108 D496G possibly damaging Het
Ilf3 A G 9: 21,399,215 T547A possibly damaging Het
Insrr C A 3: 87,808,671 P558T possibly damaging Het
Ints9 A G 14: 65,028,932 D411G possibly damaging Het
Irak3 T A 10: 120,145,908 H393L probably damaging Het
Isx G A 8: 74,873,670 M10I probably benign Het
Itga11 A G 9: 62,761,588 D709G probably damaging Het
Kcng2 G T 18: 80,295,715 R453S probably benign Het
Kif5b A G 18: 6,214,011 V664A probably benign Het
Lalba A G 15: 98,482,541 L44P probably benign Het
Ldlrad1 T G 4: 107,209,518 F17V probably benign Het
Lnx1 C T 5: 74,620,192 D382N probably damaging Het
Lrp1 T C 10: 127,593,848 Y451C probably damaging Het
Lrp2 A T 2: 69,480,062 N2722K possibly damaging Het
Mctp1 G A 13: 76,825,272 V431I probably benign Het
Mmrn2 T C 14: 34,403,059 F866L possibly damaging Het
Mylk2 A G 2: 152,917,410 E367G probably damaging Het
Nfatc1 A G 18: 80,635,579 S865P probably damaging Het
Nol6 G C 4: 41,123,526 T74R probably damaging Het
Notch2 T C 3: 98,146,321 M2100T probably benign Het
Parp1 A G 1: 180,591,276 K667R possibly damaging Het
Phlda3 A G 1: 135,766,662 T72A probably damaging Het
Polg T C 7: 79,455,522 Q758R probably benign Het
Polq G A 16: 37,048,563 R765H probably damaging Het
Prkd1 T C 12: 50,392,979 D355G possibly damaging Het
Prpf8 T C 11: 75,491,826 Y398H probably damaging Het
Ripk1 T C 13: 34,026,748 Y309H probably damaging Het
Rngtt A T 4: 33,339,032 Q279L possibly damaging Het
Samd4 T A 14: 47,077,585 V114D probably benign Het
Sec23ip G A 7: 128,779,176 E956K probably damaging Het
Slc4a1ap A T 5: 31,527,403 T128S probably benign Het
Slc5a11 A T 7: 123,235,635 I6F probably benign Het
Slc6a19 A C 13: 73,683,975 L494R probably damaging Het
Slc6a21 A G 7: 45,287,289 D189G probably damaging Het
Slc7a1 G T 5: 148,340,562 A381D probably damaging Het
Smc4 T A 3: 69,016,647 probably null Het
Stk19 T C 17: 34,832,528 E17G probably damaging Het
Tekt5 A C 16: 10,358,013 V556G probably benign Het
Tenm4 T C 7: 96,894,863 F2029L probably benign Het
Thnsl1 T C 2: 21,212,425 V330A probably damaging Het
Tnfrsf21 A G 17: 43,065,019 D432G probably damaging Het
Tnip1 T A 11: 54,926,790 S244C probably benign Het
Tnrc6c A T 11: 117,742,958 N1294I possibly damaging Het
Trpm3 A G 19: 22,988,017 I1625M probably benign Het
Ttn A T 2: 76,745,429 V25040E probably damaging Het
Vwa5a A G 9: 38,722,557 N19D possibly damaging Het
Washc2 A T 6: 116,220,556 D250V probably damaging Het
Xpo1 A G 11: 23,287,401 T755A possibly damaging Het
Zfp462 C T 4: 55,008,934 T300I possibly damaging Het
Zfp937 A C 2: 150,238,511 T154P probably damaging Het
Zzef1 A G 11: 72,888,170 D1819G probably benign Het
Other mutations in Gabbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Gabbr1 APN 17 37048443 nonsense probably null
IGL01309:Gabbr1 APN 17 37048607 critical splice donor site probably null
IGL01413:Gabbr1 APN 17 37062706 missense possibly damaging 0.93
IGL01568:Gabbr1 APN 17 37070669 missense probably damaging 1.00
IGL01845:Gabbr1 APN 17 37048414 splice site probably benign
IGL02083:Gabbr1 APN 17 37070065 missense possibly damaging 0.84
IGL02302:Gabbr1 APN 17 37054797 missense probably damaging 1.00
IGL02430:Gabbr1 APN 17 37056308 nonsense probably null
IGL02533:Gabbr1 APN 17 37072147 missense probably damaging 1.00
IGL02810:Gabbr1 APN 17 37062762 missense probably damaging 1.00
H8562:Gabbr1 UTSW 17 37071949 missense probably damaging 1.00
PIT4449001:Gabbr1 UTSW 17 37056350 missense probably damaging 1.00
R0025:Gabbr1 UTSW 17 37067210 intron probably benign
R0420:Gabbr1 UTSW 17 37046762 missense possibly damaging 0.68
R0464:Gabbr1 UTSW 17 37050834 unclassified probably benign
R1306:Gabbr1 UTSW 17 37055990 intron probably null
R1412:Gabbr1 UTSW 17 37054913 splice site probably null
R1495:Gabbr1 UTSW 17 37055940 missense possibly damaging 0.68
R1612:Gabbr1 UTSW 17 37070669 missense probably damaging 1.00
R1658:Gabbr1 UTSW 17 37047507 missense probably damaging 0.96
R1763:Gabbr1 UTSW 17 37054767 missense probably damaging 1.00
R1779:Gabbr1 UTSW 17 37054879 missense probably damaging 1.00
R1964:Gabbr1 UTSW 17 37048459 missense probably damaging 1.00
R1996:Gabbr1 UTSW 17 37069220 missense probably damaging 1.00
R2014:Gabbr1 UTSW 17 37056782 splice site probably null
R2255:Gabbr1 UTSW 17 37071866 missense probably damaging 1.00
R4299:Gabbr1 UTSW 17 37055900 nonsense probably null
R4458:Gabbr1 UTSW 17 37067775 critical splice acceptor site probably null
R4511:Gabbr1 UTSW 17 37069211 missense probably damaging 1.00
R4571:Gabbr1 UTSW 17 37054236 nonsense probably null
R4597:Gabbr1 UTSW 17 37056899 missense possibly damaging 0.74
R5109:Gabbr1 UTSW 17 37072028 intron probably benign
R5119:Gabbr1 UTSW 17 37048438 missense probably damaging 0.99
R5227:Gabbr1 UTSW 17 37070066 missense possibly damaging 0.93
R5253:Gabbr1 UTSW 17 37055913 missense possibly damaging 0.87
R5443:Gabbr1 UTSW 17 37070756 missense probably damaging 1.00
R5485:Gabbr1 UTSW 17 37056875 missense possibly damaging 0.83
R5839:Gabbr1 UTSW 17 37067868 missense probably damaging 1.00
R5976:Gabbr1 UTSW 17 37067862 missense probably damaging 1.00
R6156:Gabbr1 UTSW 17 37048427 missense probably benign 0.01
R6167:Gabbr1 UTSW 17 37063379 missense probably damaging 1.00
R6214:Gabbr1 UTSW 17 37069365 missense probably damaging 1.00
R6215:Gabbr1 UTSW 17 37069365 missense probably damaging 1.00
R6348:Gabbr1 UTSW 17 37056899 missense possibly damaging 0.94
R6721:Gabbr1 UTSW 17 37054192 missense probably damaging 0.98
R7028:Gabbr1 UTSW 17 37064737 nonsense probably null
R7317:Gabbr1 UTSW 17 37069413 missense probably damaging 1.00
X0010:Gabbr1 UTSW 17 37070780 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAATACCCTGGTGCTGTAGC -3'
(R):5'- GTCCACAATCTGCCAGATGG -3'

Sequencing Primer
(F):5'- ATGGGTGAATGCAGACCCCTTC -3'
(R):5'- GCAAGAGTCAGGATATCCATGCC -3'
Posted On2015-07-21