Incidental Mutation 'R4512:Ndst3'
ID331252
Institutional Source Beutler Lab
Gene Symbol Ndst3
Ensembl Gene ENSMUSG00000027977
Gene NameN-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Synonyms4930511P15Rik, 4921531K01Rik
MMRRC Submission 041587-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock #R4512 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location123526166-123690853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123671666 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 219 (D219G)
Ref Sequence ENSEMBL: ENSMUSP00000133657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029602] [ENSMUST00000137404] [ENSMUST00000154668] [ENSMUST00000172537]
Predicted Effect probably damaging
Transcript: ENSMUST00000029602
AA Change: D219G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029602
Gene: ENSMUSG00000027977
AA Change: D219G

DomainStartEndE-ValueType
Pfam:HSNSD 19 506 4.6e-272 PFAM
Pfam:Sulfotransfer_1 595 858 8.4e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000137404
AA Change: D219G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118796
Gene: ENSMUSG00000027977
AA Change: D219G

DomainStartEndE-ValueType
Pfam:HSNSD 19 506 6.4e-272 PFAM
PDB:1NST|A 549 637 2e-38 PDB
SCOP:d1nsta_ 570 641 9e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154668
AA Change: D219G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118207
Gene: ENSMUSG00000027977
AA Change: D219G

DomainStartEndE-ValueType
Pfam:HSNSD 20 506 1.7e-253 PFAM
Pfam:Sulfotransfer_1 595 858 8.4e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172537
AA Change: D219G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133657
Gene: ENSMUSG00000027977
AA Change: D219G

DomainStartEndE-ValueType
Pfam:HSNSD 20 328 2.4e-130 PFAM
Pfam:HSNSD 326 425 8.2e-62 PFAM
PDB:1NST|A 468 556 7e-39 PDB
SCOP:d1nsta_ 489 560 5e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199046
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. This monomeric bifunctional enzyme catalyzes the N-deacetylation and N-sulfation of N-acetylglucosamine residues in heparan sulfate and heparin, which are the initial chemical modifications required for the biosynthesis of the functional oligosaccharide sequences that define the specific ligand binding activities of heparan sulfate and heparin. [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knockout allele exhibit decreased anxiety-related behavior, cholesterol levels and CD8+ T cells due to moderate heparan-sulfate undersulfation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,156,667 T497S probably damaging Het
Abcb4 A T 5: 8,928,573 D573V probably damaging Het
Adgrg5 T C 8: 94,934,024 V93A possibly damaging Het
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Alpk1 T C 3: 127,684,471 probably benign Het
Atp6v1h T C 1: 5,098,135 probably null Het
Aup1 C T 6: 83,056,387 R248* probably null Het
BC016579 C A 16: 45,633,000 A151S possibly damaging Het
Cenpn A G 8: 116,933,396 Y68C probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Chsy3 A G 18: 59,410,187 D799G probably damaging Het
Dnah6 G A 6: 73,178,416 R739W probably damaging Het
Dync2h1 A T 9: 7,085,009 C553* probably null Het
Fhl4 A G 10: 85,098,714 S68P possibly damaging Het
Gcc1 T C 6: 28,419,209 E375G probably benign Het
Gm10110 A G 14: 89,897,715 noncoding transcript Het
Hspbap1 C T 16: 35,787,241 S39F probably damaging Het
Lmln G A 16: 33,088,137 R311Q probably benign Het
Ly6e T A 15: 74,957,833 V24D probably damaging Het
Magi3 T C 3: 104,089,555 T225A probably damaging Het
Mark1 C A 1: 184,907,089 R577L probably benign Het
Mlxip G T 5: 123,395,065 V46L probably benign Het
Mrpl40 T C 16: 18,872,558 D134G probably benign Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nalcn T C 14: 123,295,448 Y1300C probably damaging Het
Nav3 T C 10: 109,694,082 I2133V possibly damaging Het
Nfkbie C T 17: 45,556,239 S100L probably benign Het
Oard1 A G 17: 48,416,760 I145V probably benign Het
Odf2 C T 2: 29,926,097 probably null Het
Olfr1033 T C 2: 86,041,569 S85P probably damaging Het
Olfr574 T C 7: 102,948,738 L81P probably damaging Het
Olfr733 C A 14: 50,298,996 L104F probably damaging Het
Oplah A G 15: 76,297,955 L1035P probably damaging Het
Otud7a T C 7: 63,729,877 F284L probably benign Het
Parg T C 14: 32,262,736 V241A probably damaging Het
Pla2g4a T A 1: 149,861,051 probably null Het
Psd4 C T 2: 24,402,889 R684C probably damaging Het
Pttg1ip T C 10: 77,597,068 probably benign Het
R3hcc1 A G 14: 69,698,611 S250P probably damaging Het
Rere T A 4: 150,477,452 Y272N unknown Het
Selplg A G 5: 113,819,063 V394A probably benign Het
Senp7 T G 16: 56,165,883 F559V probably damaging Het
Slc16a7 T G 10: 125,233,439 probably null Het
Smim3 A T 18: 60,475,484 V32D probably damaging Het
Spsb3 A G 17: 24,890,296 D47G probably damaging Het
St6gal2 A T 17: 55,483,017 N351Y probably benign Het
Stk11 T C 10: 80,126,377 probably benign Het
Susd1 A T 4: 59,329,491 L646Q possibly damaging Het
Tmprss11a A G 5: 86,428,578 V138A probably benign Het
Ttn T C 2: 76,750,470 K15033E probably damaging Het
Ttn C A 2: 76,898,625 probably benign Het
Tyrp1 G T 4: 80,837,512 D173Y probably damaging Het
Uncx A G 5: 139,546,767 I196V possibly damaging Het
Vamp4 A T 1: 162,577,888 D28V possibly damaging Het
Vmn2r78 C T 7: 86,920,244 S115F probably benign Het
Zeb1 G A 18: 5,759,007 C138Y probably damaging Het
Zfp985 G A 4: 147,583,563 C296Y probably damaging Het
Other mutations in Ndst3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Ndst3 APN 3 123627950 splice site probably benign
IGL00543:Ndst3 APN 3 123672263 missense probably damaging 0.99
IGL01067:Ndst3 APN 3 123546817 missense probably damaging 1.00
IGL01301:Ndst3 APN 3 123548916 missense probably damaging 0.97
IGL01975:Ndst3 APN 3 123601514 missense possibly damaging 0.67
IGL02376:Ndst3 APN 3 123556798 missense probably damaging 0.98
IGL02715:Ndst3 APN 3 123546761 splice site probably benign
IGL03111:Ndst3 APN 3 123672096 missense possibly damaging 0.96
Jack_sprat UTSW 3 123552552 missense probably damaging 0.99
ANU18:Ndst3 UTSW 3 123548916 missense probably damaging 0.97
R0027:Ndst3 UTSW 3 123671513 missense probably damaging 1.00
R0288:Ndst3 UTSW 3 123672194 missense probably benign 0.03
R0630:Ndst3 UTSW 3 123562071 missense probably damaging 0.98
R1168:Ndst3 UTSW 3 123606968 missense probably benign 0.22
R1400:Ndst3 UTSW 3 123556828 missense probably damaging 1.00
R1513:Ndst3 UTSW 3 123601455 missense possibly damaging 0.75
R1524:Ndst3 UTSW 3 123548906 missense possibly damaging 0.94
R1830:Ndst3 UTSW 3 123548938 missense probably damaging 0.96
R1831:Ndst3 UTSW 3 123601478 missense probably benign
R1865:Ndst3 UTSW 3 123671471 missense probably damaging 1.00
R1871:Ndst3 UTSW 3 123562024 missense probably damaging 1.00
R2041:Ndst3 UTSW 3 123672215 missense probably benign 0.01
R2056:Ndst3 UTSW 3 123671885 missense probably damaging 0.98
R2362:Ndst3 UTSW 3 123552678 missense possibly damaging 0.94
R2484:Ndst3 UTSW 3 123552537 missense possibly damaging 0.83
R3747:Ndst3 UTSW 3 123671552 missense probably benign 0.09
R4152:Ndst3 UTSW 3 123672227 missense probably damaging 1.00
R4153:Ndst3 UTSW 3 123672227 missense probably damaging 1.00
R4154:Ndst3 UTSW 3 123672227 missense probably damaging 1.00
R4579:Ndst3 UTSW 3 123546825 missense probably benign 0.00
R4611:Ndst3 UTSW 3 123671549 missense probably benign 0.35
R4646:Ndst3 UTSW 3 123672035 missense probably damaging 0.96
R4718:Ndst3 UTSW 3 123672266 missense probably benign 0.35
R4944:Ndst3 UTSW 3 123607027 missense probably damaging 0.99
R4945:Ndst3 UTSW 3 123552552 missense probably damaging 1.00
R5179:Ndst3 UTSW 3 123552532 missense probably damaging 0.97
R5232:Ndst3 UTSW 3 123672239 missense probably damaging 0.99
R5421:Ndst3 UTSW 3 123634359 intron probably null
R5874:Ndst3 UTSW 3 123561907 missense probably damaging 1.00
R6030:Ndst3 UTSW 3 123552519 missense probably damaging 1.00
R6030:Ndst3 UTSW 3 123552519 missense probably damaging 1.00
R6228:Ndst3 UTSW 3 123671652 nonsense probably null
R6496:Ndst3 UTSW 3 123552552 missense probably damaging 0.99
R6562:Ndst3 UTSW 3 123552532 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCTTCCCCGACAAGAAGGAG -3'
(R):5'- CATTGGATTCCATAAAACCAGTGAG -3'

Sequencing Primer
(F):5'- AGCCAGAAGTTCAAGTTGTTGCC -3'
(R):5'- CAGTGAGAAAAATCTACAGAGCTTTC -3'
Posted On2015-07-21