Incidental Mutation 'R4512:Rere'
ID331258
Institutional Source Beutler Lab
Gene Symbol Rere
Ensembl Gene ENSMUSG00000039852
Gene Namearginine glutamic acid dipeptide (RE) repeats
Synonyms1110033A15Rik, eyes3, Atr2, eye, atrophin-2
MMRRC Submission 041587-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4512 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location150281646-150621966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 150477452 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 272 (Y272N)
Ref Sequence ENSEMBL: ENSMUSP00000101307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105682]
Predicted Effect unknown
Transcript: ENSMUST00000105682
AA Change: Y272N
SMART Domains Protein: ENSMUSP00000101307
Gene: ENSMUSG00000039852
AA Change: Y272N

DomainStartEndE-ValueType
low complexity region 3 31 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
BAH 103 283 3.52e-13 SMART
ELM2 286 338 1.67e-13 SMART
SANT 392 441 1.8e-6 SMART
low complexity region 444 461 N/A INTRINSIC
ZnF_GATA 501 552 1.94e-15 SMART
Pfam:Atrophin-1 568 1557 N/A PFAM
Meta Mutation Damage Score 0.618 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the atrophin family of arginine-glutamic acid (RE) dipeptide repeat-containing proteins. The encoded protein co-localizes with a transcription factor in the nucleus, and its overexpression triggers apoptosis. A similar protein in mouse associates with histone deacetylase and is thought to function as a transcriptional co-repressor during embryonic development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality with abnormalities in neural tube development, somite development, and in the embryonic heart. Mice homozygous for an ENU-induced allele exhibit narrow snouts, decreased body weight, renal agenesis and small eyes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,156,667 T497S probably damaging Het
Abcb4 A T 5: 8,928,573 D573V probably damaging Het
Adgrg5 T C 8: 94,934,024 V93A possibly damaging Het
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Alpk1 T C 3: 127,684,471 probably benign Het
Atp6v1h T C 1: 5,098,135 probably null Het
Aup1 C T 6: 83,056,387 R248* probably null Het
BC016579 C A 16: 45,633,000 A151S possibly damaging Het
Cenpn A G 8: 116,933,396 Y68C probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Chsy3 A G 18: 59,410,187 D799G probably damaging Het
Dnah6 G A 6: 73,178,416 R739W probably damaging Het
Dync2h1 A T 9: 7,085,009 C553* probably null Het
Fhl4 A G 10: 85,098,714 S68P possibly damaging Het
Gcc1 T C 6: 28,419,209 E375G probably benign Het
Gm10110 A G 14: 89,897,715 noncoding transcript Het
Hspbap1 C T 16: 35,787,241 S39F probably damaging Het
Lmln G A 16: 33,088,137 R311Q probably benign Het
Ly6e T A 15: 74,957,833 V24D probably damaging Het
Magi3 T C 3: 104,089,555 T225A probably damaging Het
Mark1 C A 1: 184,907,089 R577L probably benign Het
Mlxip G T 5: 123,395,065 V46L probably benign Het
Mrpl40 T C 16: 18,872,558 D134G probably benign Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nalcn T C 14: 123,295,448 Y1300C probably damaging Het
Nav3 T C 10: 109,694,082 I2133V possibly damaging Het
Ndst3 T C 3: 123,671,666 D219G probably damaging Het
Nfkbie C T 17: 45,556,239 S100L probably benign Het
Oard1 A G 17: 48,416,760 I145V probably benign Het
Odf2 C T 2: 29,926,097 probably null Het
Olfr1033 T C 2: 86,041,569 S85P probably damaging Het
Olfr574 T C 7: 102,948,738 L81P probably damaging Het
Olfr733 C A 14: 50,298,996 L104F probably damaging Het
Oplah A G 15: 76,297,955 L1035P probably damaging Het
Otud7a T C 7: 63,729,877 F284L probably benign Het
Parg T C 14: 32,262,736 V241A probably damaging Het
Pla2g4a T A 1: 149,861,051 probably null Het
Psd4 C T 2: 24,402,889 R684C probably damaging Het
Pttg1ip T C 10: 77,597,068 probably benign Het
R3hcc1 A G 14: 69,698,611 S250P probably damaging Het
Selplg A G 5: 113,819,063 V394A probably benign Het
Senp7 T G 16: 56,165,883 F559V probably damaging Het
Slc16a7 T G 10: 125,233,439 probably null Het
Smim3 A T 18: 60,475,484 V32D probably damaging Het
Spsb3 A G 17: 24,890,296 D47G probably damaging Het
St6gal2 A T 17: 55,483,017 N351Y probably benign Het
Stk11 T C 10: 80,126,377 probably benign Het
Susd1 A T 4: 59,329,491 L646Q possibly damaging Het
Tmprss11a A G 5: 86,428,578 V138A probably benign Het
Ttn T C 2: 76,750,470 K15033E probably damaging Het
Ttn C A 2: 76,898,625 probably benign Het
Tyrp1 G T 4: 80,837,512 D173Y probably damaging Het
Uncx A G 5: 139,546,767 I196V possibly damaging Het
Vamp4 A T 1: 162,577,888 D28V possibly damaging Het
Vmn2r78 C T 7: 86,920,244 S115F probably benign Het
Zeb1 G A 18: 5,759,007 C138Y probably damaging Het
Zfp985 G A 4: 147,583,563 C296Y probably damaging Het
Other mutations in Rere
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Rere APN 4 150619463 missense probably damaging 1.00
IGL01465:Rere APN 4 150509994 missense unknown
IGL01523:Rere APN 4 150615555 missense possibly damaging 0.93
IGL01688:Rere APN 4 150618436 missense probably damaging 1.00
IGL02057:Rere APN 4 150614832 unclassified probably benign
IGL02621:Rere APN 4 150613812 unclassified probably benign
IGL02672:Rere APN 4 150510026 missense unknown
R0116:Rere UTSW 4 150616976 missense probably benign 0.18
R0119:Rere UTSW 4 150615322 unclassified probably benign
R0344:Rere UTSW 4 150610981 unclassified probably benign
R0504:Rere UTSW 4 150615322 unclassified probably benign
R0630:Rere UTSW 4 150619088 missense probably damaging 1.00
R0961:Rere UTSW 4 150615372 unclassified probably benign
R1164:Rere UTSW 4 150534884 missense unknown
R1424:Rere UTSW 4 150617038 missense probably damaging 1.00
R1542:Rere UTSW 4 150615942 missense probably damaging 1.00
R1652:Rere UTSW 4 150612065 unclassified probably benign
R1953:Rere UTSW 4 150616837 missense probably damaging 1.00
R1959:Rere UTSW 4 150468790 missense probably benign 0.23
R1966:Rere UTSW 4 150616873 missense probably damaging 1.00
R1975:Rere UTSW 4 150615733 missense probably damaging 0.99
R2070:Rere UTSW 4 150614590 unclassified probably benign
R2115:Rere UTSW 4 150612561 unclassified probably benign
R2144:Rere UTSW 4 150616931 missense probably damaging 0.99
R2270:Rere UTSW 4 150477380 missense unknown
R2969:Rere UTSW 4 150570216 missense unknown
R3699:Rere UTSW 4 150477362 critical splice acceptor site probably null
R3723:Rere UTSW 4 150468795 missense probably damaging 1.00
R3826:Rere UTSW 4 150470328 missense probably benign 0.42
R4234:Rere UTSW 4 150617405 missense probably damaging 1.00
R4798:Rere UTSW 4 150615167 unclassified probably benign
R4883:Rere UTSW 4 150616053 missense probably damaging 0.98
R4914:Rere UTSW 4 150619144 missense probably damaging 1.00
R4916:Rere UTSW 4 150619144 missense probably damaging 1.00
R4917:Rere UTSW 4 150619144 missense probably damaging 1.00
R4918:Rere UTSW 4 150619144 missense probably damaging 1.00
R4966:Rere UTSW 4 150613816 unclassified probably benign
R5172:Rere UTSW 4 150570269 missense unknown
R5643:Rere UTSW 4 150617243 missense probably damaging 1.00
R6058:Rere UTSW 4 150468798 missense probably damaging 1.00
R7112:Rere UTSW 4 150406604 missense probably benign
R7173:Rere UTSW 4 150468738 missense probably damaging 1.00
R7190:Rere UTSW 4 150610953 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGCCAATGAAGCGTGAACAC -3'
(R):5'- CATACCTTTCCTTGCCTAACCAAAG -3'

Sequencing Primer
(F):5'- ATATATTCTATGCTTCCCTCACCC -3'
(R):5'- TTTCCTTGCCTAACCAAAGCAAAGG -3'
Posted On2015-07-21