Incidental Mutation 'R0099:Prdm14'
ID33127
Institutional Source Beutler Lab
Gene Symbol Prdm14
Ensembl Gene ENSMUSG00000042414
Gene NamePR domain containing 14
Synonyms
MMRRC Submission 038385-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0099 (G1)
Quality Score225
Status Validated (trace)
Chromosome1
Chromosomal Location13113457-13127163 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13118945 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 392 (C392S)
Ref Sequence ENSEMBL: ENSMUSP00000044245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047577]
Predicted Effect probably damaging
Transcript: ENSMUST00000047577
AA Change: C392S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000044245
Gene: ENSMUSG00000042414
AA Change: C392S

DomainStartEndE-ValueType
low complexity region 120 139 N/A INTRINSIC
SET 244 362 2.8e-11 SMART
low complexity region 373 389 N/A INTRINSIC
ZnF_C2H2 390 410 1.4e-1 SMART
ZnF_C2H2 422 445 5.3e-5 SMART
ZnF_C2H2 451 473 3.2e-7 SMART
ZnF_C2H2 479 501 1.4e-4 SMART
ZnF_C2H2 507 530 8.1e-5 SMART
ZnF_C2H2 536 558 4.6e-4 SMART
Meta Mutation Damage Score 0.376 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PRDI-BF1 and RIZ homology domain containing (PRDM) family of transcriptional regulators. The encoded protein may possess histone methyltransferase activity and plays a critical role in cell pluripotency by suppressing the expression of differentiation marker genes. Expression of this gene may play a role in breast cancer. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knockout allele exhibit decreased primordial germ cell numbers, absent germ cells, and sterility in both males and females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930018M24Rik C T 14: 50,896,722 probably benign Het
Acad10 A C 5: 121,621,290 D1043E probably damaging Het
Adamtsl4 C T 3: 95,684,139 G173R probably benign Het
Astn1 G T 1: 158,502,151 S192I probably damaging Het
Atg2a T A 19: 6,252,789 V1010E probably damaging Het
C130079G13Rik A C 3: 59,936,435 K183N probably benign Het
Col11a2 A G 17: 34,049,674 E311G probably damaging Het
Col4a3 A C 1: 82,717,993 E1638A probably benign Het
Cstf2t A G 19: 31,083,831 R256G probably benign Het
Cyp4a12a T C 4: 115,326,672 L225P probably damaging Het
Diexf A G 1: 193,128,470 L75P probably damaging Het
Dnah5 G A 15: 28,239,934 R479H probably damaging Het
Dsg3 A G 18: 20,540,022 I917V probably benign Het
Fam76a G T 4: 132,910,787 probably benign Het
Fras1 T A 5: 96,614,917 probably null Het
Gli1 A G 10: 127,336,006 V293A probably damaging Het
Gm10782 T A 13: 56,363,143 noncoding transcript Het
Greb1l A G 18: 10,509,158 E490G probably damaging Het
Hydin G A 8: 110,589,561 G4362R probably damaging Het
Ica1 A T 6: 8,749,778 probably benign Het
Ikzf4 T A 10: 128,634,197 I485F probably damaging Het
Irf5 A G 6: 29,533,967 T34A probably damaging Het
Krt81 A T 15: 101,463,521 C59* probably null Het
Kynu T A 2: 43,629,053 probably null Het
Ly6g6c T C 17: 35,068,915 V61A probably damaging Het
Manea A C 4: 26,328,104 I312M probably damaging Het
Micall1 G T 15: 79,131,901 probably benign Het
Mthfs A T 9: 89,226,163 probably benign Het
Myh4 A G 11: 67,259,347 T1877A probably benign Het
Myo3a T C 2: 22,245,598 I92T probably benign Het
Nepn A G 10: 52,401,085 S306G probably damaging Het
Nol8 T C 13: 49,672,689 V995A probably benign Het
Olfr1453 A G 19: 13,027,801 F176S probably damaging Het
Olfr1458 T A 19: 13,103,140 T49S probably benign Het
Olfr160 A T 9: 37,711,454 V275E probably damaging Het
Olfr967 A G 9: 39,750,661 I92V possibly damaging Het
Pde1a T A 2: 79,868,313 probably null Het
Phf14 A G 6: 11,987,697 probably benign Het
Plekhh2 C T 17: 84,591,672 Q1026* probably null Het
Polr2b T A 5: 77,320,950 probably benign Het
Ppp1r36 G T 12: 76,436,282 probably null Het
Rabgap1l A G 1: 160,682,116 S436P possibly damaging Het
Rfc2 A T 5: 134,595,281 probably null Het
Rfx4 A T 10: 84,894,304 M437L probably benign Het
Rgs17 T A 10: 5,842,583 R74S probably benign Het
Rnf139 C A 15: 58,899,415 L430I probably damaging Het
Sgsm1 C A 5: 113,274,360 probably benign Het
Skint6 T A 4: 112,811,501 T1126S possibly damaging Het
Slc15a2 T C 16: 36,753,036 E602G probably damaging Het
Stpg2 T C 3: 139,243,193 probably benign Het
Sycp2l T C 13: 41,129,525 probably benign Het
Tlr11 A T 14: 50,360,818 N87I probably benign Het
Tril A G 6: 53,818,363 F625L probably damaging Het
Ube3c T A 5: 29,607,064 V434E probably damaging Het
Usp34 G A 11: 23,363,111 G533R probably damaging Het
Zfp93 G T 7: 24,275,475 R295L probably benign Het
Other mutations in Prdm14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02149:Prdm14 APN 1 13125439 missense probably benign 0.07
R0243:Prdm14 UTSW 1 13122448 missense probably damaging 1.00
R0312:Prdm14 UTSW 1 13118807 missense probably damaging 1.00
R0576:Prdm14 UTSW 1 13125725 missense possibly damaging 0.87
R0781:Prdm14 UTSW 1 13114361 missense probably damaging 0.99
R0791:Prdm14 UTSW 1 13125744 missense probably benign 0.30
R0792:Prdm14 UTSW 1 13125744 missense probably benign 0.30
R0855:Prdm14 UTSW 1 13125537 missense probably benign 0.00
R0905:Prdm14 UTSW 1 13125438 missense probably benign 0.00
R1467:Prdm14 UTSW 1 13124532 splice site probably benign
R1747:Prdm14 UTSW 1 13122403 missense possibly damaging 0.83
R1771:Prdm14 UTSW 1 13118858 missense probably damaging 1.00
R2073:Prdm14 UTSW 1 13125730 missense possibly damaging 0.95
R2170:Prdm14 UTSW 1 13122460 missense probably damaging 1.00
R2432:Prdm14 UTSW 1 13125633 missense probably benign
R4948:Prdm14 UTSW 1 13122631 missense probably damaging 1.00
R6267:Prdm14 UTSW 1 13118936 missense probably damaging 1.00
R6902:Prdm14 UTSW 1 13122421 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTTCTAGTCAGTCCCATGAACCCC -3'
(R):5'- GACACCTGGATCTGACACCTCTTTG -3'

Sequencing Primer
(F):5'- CTCTGTGTGTTCACGACAAG -3'
(R):5'- cttgcactcctgatttttctgcc -3'
Posted On2013-05-09