Incidental Mutation 'R4512:2010111I01Rik'
ID331280
Institutional Source Beutler Lab
Gene Symbol 2010111I01Rik
Ensembl Gene ENSMUSG00000021458
Gene NameRIKEN cDNA 2010111I01 gene
SynonymsApO, aminopeptidase O
MMRRC Submission 041587-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R4512 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location62964893-63326096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 63156667 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 497 (T497S)
Ref Sequence ENSEMBL: ENSMUSP00000021911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021911] [ENSMUST00000091560] [ENSMUST00000222907]
Predicted Effect probably damaging
Transcript: ENSMUST00000021911
AA Change: T497S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021911
Gene: ENSMUSG00000021458
AA Change: T497S

DomainStartEndE-ValueType
low complexity region 143 154 N/A INTRINSIC
Pfam:Peptidase_M1 221 359 5.4e-11 PFAM
Pfam:Peptidase_M1 385 558 2.3e-15 PFAM
Pfam:Peptidase_MA_2 453 613 1.3e-12 PFAM
Leuk-A4-hydro_C 675 821 3.02e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000091560
AA Change: T498S

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000089148
Gene: ENSMUSG00000021458
AA Change: T498S

DomainStartEndE-ValueType
low complexity region 143 154 N/A INTRINSIC
Pfam:Peptidase_M1 220 359 2.7e-11 PFAM
Pfam:Peptidase_M1 386 561 1.9e-15 PFAM
Leuk-A4-hydro_C 676 822 3.02e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220457
Predicted Effect unknown
Transcript: ENSMUST00000220863
AA Change: T389S
Predicted Effect probably benign
Transcript: ENSMUST00000221676
Predicted Effect probably benign
Transcript: ENSMUST00000222907
Meta Mutation Damage Score 0.244 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the M1 zinc aminopeptidase family. The encoded protein is a zinc-dependent metallopeptidase that catalyzes the removal of an amino acid from the amino terminus of a protein or peptide. This protein may play a role in the generation of angiotensin IV. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for one gene trapped allele are phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,928,573 D573V probably damaging Het
Adgrg5 T C 8: 94,934,024 V93A possibly damaging Het
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Alpk1 T C 3: 127,684,471 probably benign Het
Atp6v1h T C 1: 5,098,135 probably null Het
Aup1 C T 6: 83,056,387 R248* probably null Het
BC016579 C A 16: 45,633,000 A151S possibly damaging Het
Cenpn A G 8: 116,933,396 Y68C probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Chsy3 A G 18: 59,410,187 D799G probably damaging Het
Dnah6 G A 6: 73,178,416 R739W probably damaging Het
Dync2h1 A T 9: 7,085,009 C553* probably null Het
Fhl4 A G 10: 85,098,714 S68P possibly damaging Het
Gcc1 T C 6: 28,419,209 E375G probably benign Het
Gm10110 A G 14: 89,897,715 noncoding transcript Het
Hspbap1 C T 16: 35,787,241 S39F probably damaging Het
Lmln G A 16: 33,088,137 R311Q probably benign Het
Ly6e T A 15: 74,957,833 V24D probably damaging Het
Magi3 T C 3: 104,089,555 T225A probably damaging Het
Mark1 C A 1: 184,907,089 R577L probably benign Het
Mlxip G T 5: 123,395,065 V46L probably benign Het
Mrpl40 T C 16: 18,872,558 D134G probably benign Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nalcn T C 14: 123,295,448 Y1300C probably damaging Het
Nav3 T C 10: 109,694,082 I2133V possibly damaging Het
Ndst3 T C 3: 123,671,666 D219G probably damaging Het
Nfkbie C T 17: 45,556,239 S100L probably benign Het
Oard1 A G 17: 48,416,760 I145V probably benign Het
Odf2 C T 2: 29,926,097 probably null Het
Olfr1033 T C 2: 86,041,569 S85P probably damaging Het
Olfr574 T C 7: 102,948,738 L81P probably damaging Het
Olfr733 C A 14: 50,298,996 L104F probably damaging Het
Oplah A G 15: 76,297,955 L1035P probably damaging Het
Otud7a T C 7: 63,729,877 F284L probably benign Het
Parg T C 14: 32,262,736 V241A probably damaging Het
Pla2g4a T A 1: 149,861,051 probably null Het
Psd4 C T 2: 24,402,889 R684C probably damaging Het
Pttg1ip T C 10: 77,597,068 probably benign Het
R3hcc1 A G 14: 69,698,611 S250P probably damaging Het
Rere T A 4: 150,477,452 Y272N unknown Het
Selplg A G 5: 113,819,063 V394A probably benign Het
Senp7 T G 16: 56,165,883 F559V probably damaging Het
Slc16a7 T G 10: 125,233,439 probably null Het
Smim3 A T 18: 60,475,484 V32D probably damaging Het
Spsb3 A G 17: 24,890,296 D47G probably damaging Het
St6gal2 A T 17: 55,483,017 N351Y probably benign Het
Stk11 T C 10: 80,126,377 probably benign Het
Susd1 A T 4: 59,329,491 L646Q possibly damaging Het
Tmprss11a A G 5: 86,428,578 V138A probably benign Het
Ttn T C 2: 76,750,470 K15033E probably damaging Het
Ttn C A 2: 76,898,625 probably benign Het
Tyrp1 G T 4: 80,837,512 D173Y probably damaging Het
Uncx A G 5: 139,546,767 I196V possibly damaging Het
Vamp4 A T 1: 162,577,888 D28V possibly damaging Het
Vmn2r78 C T 7: 86,920,244 S115F probably benign Het
Zeb1 G A 18: 5,759,007 C138Y probably damaging Het
Zfp985 G A 4: 147,583,563 C296Y probably damaging Het
Other mutations in 2010111I01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:2010111I01Rik APN 13 63199500 splice site probably benign
IGL00329:2010111I01Rik APN 13 63191163 missense probably damaging 1.00
IGL00336:2010111I01Rik APN 13 63015423 missense possibly damaging 0.78
IGL01384:2010111I01Rik APN 13 63190476 splice site probably benign
IGL01780:2010111I01Rik APN 13 63210125 missense probably benign 0.00
IGL01876:2010111I01Rik APN 13 63190522 missense probably damaging 1.00
IGL02096:2010111I01Rik APN 13 63061089 missense probably benign 0.04
IGL02166:2010111I01Rik APN 13 63015453 missense probably benign 0.02
IGL02184:2010111I01Rik APN 13 63068111 missense possibly damaging 0.50
R0139:2010111I01Rik UTSW 13 63190484 missense probably benign 0.01
R1209:2010111I01Rik UTSW 13 63191064 unclassified probably null
R1233:2010111I01Rik UTSW 13 63199520 missense probably damaging 0.96
R1756:2010111I01Rik UTSW 13 63068061 missense possibly damaging 0.95
R1786:2010111I01Rik UTSW 13 63210149 missense probably benign 0.00
R1861:2010111I01Rik UTSW 13 63015783 missense probably damaging 1.00
R2130:2010111I01Rik UTSW 13 63210149 missense probably benign 0.00
R2131:2010111I01Rik UTSW 13 63210149 missense probably benign 0.00
R3076:2010111I01Rik UTSW 13 63240115 missense probably damaging 0.96
R3702:2010111I01Rik UTSW 13 63015330 missense probably benign 0.01
R3912:2010111I01Rik UTSW 13 63156706 nonsense probably null
R4593:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4596:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4597:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4616:2010111I01Rik UTSW 13 63298751 missense probably damaging 1.00
R4625:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4627:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4630:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4632:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4911:2010111I01Rik UTSW 13 63170939 critical splice acceptor site probably null
R5204:2010111I01Rik UTSW 13 63033090 missense probably benign 0.15
R5210:2010111I01Rik UTSW 13 63068110 missense probably benign 0.00
R5849:2010111I01Rik UTSW 13 63015498 missense probably benign 0.00
R5861:2010111I01Rik UTSW 13 63298812 missense probably damaging 1.00
R5960:2010111I01Rik UTSW 13 63240273 missense probably damaging 0.99
R6021:2010111I01Rik UTSW 13 63061082 missense probably damaging 1.00
R6048:2010111I01Rik UTSW 13 63240325 missense probably damaging 0.99
R6379:2010111I01Rik UTSW 13 63068243 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATAACAGACTCTGTGGGCTAAG -3'
(R):5'- CAAACATAGTGCTTAGTACACACAG -3'

Sequencing Primer
(F):5'- CACTGAGTAGCCACAGGGAC -3'
(R):5'- GTGCTTAGTACACACAGCATATAATC -3'
Posted On2015-07-21