Incidental Mutation 'R0099:Ube3c'
ID33141
Institutional Source Beutler Lab
Gene Symbol Ube3c
Ensembl Gene ENSMUSG00000039000
Gene Nameubiquitin protein ligase E3C
Synonyms
MMRRC Submission 038385-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.367) question?
Stock #R0099 (G1)
Quality Score225
Status Validated (trace)
Chromosome5
Chromosomal Location29569242-29676092 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29607064 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 434 (V434E)
Ref Sequence ENSEMBL: ENSMUSP00000142474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049453] [ENSMUST00000199032]
Predicted Effect probably damaging
Transcript: ENSMUST00000049453
AA Change: V434E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045998
Gene: ENSMUSG00000039000
AA Change: V434E

DomainStartEndE-ValueType
IQ 44 66 1.68e-3 SMART
low complexity region 363 376 N/A INTRINSIC
low complexity region 496 514 N/A INTRINSIC
Blast:HECTc 645 701 5e-25 BLAST
HECTc 742 1083 8.54e-178 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199032
AA Change: V434E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142474
Gene: ENSMUSG00000039000
AA Change: V434E

DomainStartEndE-ValueType
IQ 44 66 8e-6 SMART
low complexity region 363 376 N/A INTRINSIC
low complexity region 496 514 N/A INTRINSIC
Meta Mutation Damage Score 0.25 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930018M24Rik C T 14: 50,896,722 probably benign Het
Acad10 A C 5: 121,621,290 D1043E probably damaging Het
Adamtsl4 C T 3: 95,684,139 G173R probably benign Het
Astn1 G T 1: 158,502,151 S192I probably damaging Het
Atg2a T A 19: 6,252,789 V1010E probably damaging Het
C130079G13Rik A C 3: 59,936,435 K183N probably benign Het
Col11a2 A G 17: 34,049,674 E311G probably damaging Het
Col4a3 A C 1: 82,717,993 E1638A probably benign Het
Cstf2t A G 19: 31,083,831 R256G probably benign Het
Cyp4a12a T C 4: 115,326,672 L225P probably damaging Het
Diexf A G 1: 193,128,470 L75P probably damaging Het
Dnah5 G A 15: 28,239,934 R479H probably damaging Het
Dsg3 A G 18: 20,540,022 I917V probably benign Het
Fam76a G T 4: 132,910,787 probably benign Het
Fras1 T A 5: 96,614,917 probably null Het
Gli1 A G 10: 127,336,006 V293A probably damaging Het
Gm10782 T A 13: 56,363,143 noncoding transcript Het
Greb1l A G 18: 10,509,158 E490G probably damaging Het
Hydin G A 8: 110,589,561 G4362R probably damaging Het
Ica1 A T 6: 8,749,778 probably benign Het
Ikzf4 T A 10: 128,634,197 I485F probably damaging Het
Irf5 A G 6: 29,533,967 T34A probably damaging Het
Krt81 A T 15: 101,463,521 C59* probably null Het
Kynu T A 2: 43,629,053 probably null Het
Ly6g6c T C 17: 35,068,915 V61A probably damaging Het
Manea A C 4: 26,328,104 I312M probably damaging Het
Micall1 G T 15: 79,131,901 probably benign Het
Mthfs A T 9: 89,226,163 probably benign Het
Myh4 A G 11: 67,259,347 T1877A probably benign Het
Myo3a T C 2: 22,245,598 I92T probably benign Het
Nepn A G 10: 52,401,085 S306G probably damaging Het
Nol8 T C 13: 49,672,689 V995A probably benign Het
Olfr1453 A G 19: 13,027,801 F176S probably damaging Het
Olfr1458 T A 19: 13,103,140 T49S probably benign Het
Olfr160 A T 9: 37,711,454 V275E probably damaging Het
Olfr967 A G 9: 39,750,661 I92V possibly damaging Het
Pde1a T A 2: 79,868,313 probably null Het
Phf14 A G 6: 11,987,697 probably benign Het
Plekhh2 C T 17: 84,591,672 Q1026* probably null Het
Polr2b T A 5: 77,320,950 probably benign Het
Ppp1r36 G T 12: 76,436,282 probably null Het
Prdm14 A T 1: 13,118,945 C392S probably damaging Het
Rabgap1l A G 1: 160,682,116 S436P possibly damaging Het
Rfc2 A T 5: 134,595,281 probably null Het
Rfx4 A T 10: 84,894,304 M437L probably benign Het
Rgs17 T A 10: 5,842,583 R74S probably benign Het
Rnf139 C A 15: 58,899,415 L430I probably damaging Het
Sgsm1 C A 5: 113,274,360 probably benign Het
Skint6 T A 4: 112,811,501 T1126S possibly damaging Het
Slc15a2 T C 16: 36,753,036 E602G probably damaging Het
Stpg2 T C 3: 139,243,193 probably benign Het
Sycp2l T C 13: 41,129,525 probably benign Het
Tlr11 A T 14: 50,360,818 N87I probably benign Het
Tril A G 6: 53,818,363 F625L probably damaging Het
Usp34 G A 11: 23,363,111 G533R probably damaging Het
Zfp93 G T 7: 24,275,475 R295L probably benign Het
Other mutations in Ube3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Ube3c APN 5 29619229 missense probably damaging 1.00
IGL01526:Ube3c APN 5 29667962 missense probably damaging 0.99
IGL01901:Ube3c APN 5 29668007 missense probably damaging 1.00
IGL02029:Ube3c APN 5 29619328 missense probably damaging 1.00
IGL02893:Ube3c APN 5 29632763 missense probably damaging 1.00
IGL03400:Ube3c APN 5 29601347 missense probably benign 0.00
lord_business UTSW 5 29637586 splice site probably benign
R0067:Ube3c UTSW 5 29598938 missense possibly damaging 0.94
R0067:Ube3c UTSW 5 29598938 missense possibly damaging 0.94
R0606:Ube3c UTSW 5 29590928 missense probably damaging 1.00
R0755:Ube3c UTSW 5 29637742 missense probably damaging 1.00
R0900:Ube3c UTSW 5 29601346 missense probably benign 0.00
R1624:Ube3c UTSW 5 29646619 missense probably benign 0.00
R1701:Ube3c UTSW 5 29601202 missense probably benign
R1918:Ube3c UTSW 5 29587317 missense probably damaging 1.00
R1933:Ube3c UTSW 5 29619659 missense probably damaging 0.97
R2072:Ube3c UTSW 5 29635640 missense probably benign 0.02
R2095:Ube3c UTSW 5 29668040 missense probably damaging 1.00
R2122:Ube3c UTSW 5 29619606 missense probably benign 0.14
R2962:Ube3c UTSW 5 29658418 missense possibly damaging 0.81
R3605:Ube3c UTSW 5 29598938 missense possibly damaging 0.94
R3606:Ube3c UTSW 5 29598938 missense possibly damaging 0.94
R3764:Ube3c UTSW 5 29637586 splice site probably benign
R3940:Ube3c UTSW 5 29619360 missense probably benign 0.31
R4776:Ube3c UTSW 5 29632838 critical splice donor site probably null
R4794:Ube3c UTSW 5 29597085 missense probably benign 0.06
R4924:Ube3c UTSW 5 29631271 missense possibly damaging 0.56
R5059:Ube3c UTSW 5 29631295 missense probably null 0.11
R5068:Ube3c UTSW 5 29601354 critical splice donor site probably null
R5140:Ube3c UTSW 5 29635711 missense probably damaging 1.00
R5849:Ube3c UTSW 5 29658409 missense probably damaging 1.00
R5890:Ube3c UTSW 5 29658292 missense possibly damaging 0.77
R5956:Ube3c UTSW 5 29599056 intron probably benign
R6035:Ube3c UTSW 5 29601163 missense probably benign 0.00
R6035:Ube3c UTSW 5 29601163 missense probably benign 0.00
R6264:Ube3c UTSW 5 29590831 missense probably damaging 1.00
R6354:Ube3c UTSW 5 29663583 missense probably damaging 0.99
R6658:Ube3c UTSW 5 29602217 missense probably damaging 1.00
R6877:Ube3c UTSW 5 29587318 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GCAGTAGCACTTCACTCACTCAGAC -3'
(R):5'- TGCCACAGGTGTCATGGACTAAAAC -3'

Sequencing Primer
(F):5'- ACTCACTCAGACTCATTTTTCTGTTG -3'
(R):5'- AGCTGGACTAACTTGCTACTG -3'
Posted On2013-05-09