Incidental Mutation 'R4480:Plekha5'
ID331423
Institutional Source Beutler Lab
Gene Symbol Plekha5
Ensembl Gene ENSMUSG00000030231
Gene Namepleckstrin homology domain containing, family A member 5
SynonymsPEPP2, Tg(AMH-cre)1Flor, Gt(Ayu21)9Imeg, AMH-Cre, 2810431N21Rik, Ayu21-9
MMRRC Submission 041737-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R4480 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location140424054-140597110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140526479 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 44 (V44A)
Ref Sequence ENSEMBL: ENSMUSP00000144832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087622] [ENSMUST00000203517] [ENSMUST00000203774] [ENSMUST00000204145] [ENSMUST00000204876]
Predicted Effect probably damaging
Transcript: ENSMUST00000087622
AA Change: V153A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000084904
Gene: ENSMUSG00000030231
AA Change: V153A

DomainStartEndE-ValueType
WW 12 44 1.51e-3 SMART
WW 58 90 2.17e-4 SMART
PH 171 271 1.85e-17 SMART
Blast:PH 592 715 7e-39 BLAST
coiled coil region 747 781 N/A INTRINSIC
low complexity region 896 916 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
low complexity region 1206 1224 N/A INTRINSIC
low complexity region 1243 1258 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122528
Predicted Effect probably benign
Transcript: ENSMUST00000203517
AA Change: V153A

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000145478
Gene: ENSMUSG00000030231
AA Change: V153A

DomainStartEndE-ValueType
WW 12 44 9e-6 SMART
WW 58 90 1.3e-6 SMART
PH 171 271 8.6e-20 SMART
Blast:PH 586 697 3e-15 BLAST
coiled coil region 702 736 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203774
AA Change: V44A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144832
Gene: ENSMUSG00000030231
AA Change: V44A

DomainStartEndE-ValueType
PH 62 162 8.6e-20 SMART
Blast:PH 477 511 4e-8 BLAST
low complexity region 512 521 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000203955
AA Change: V76A
Predicted Effect probably benign
Transcript: ENSMUST00000204145
AA Change: V153A

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000145457
Gene: ENSMUSG00000030231
AA Change: V153A

DomainStartEndE-ValueType
WW 12 44 9e-6 SMART
WW 58 90 1.3e-6 SMART
Blast:PH 114 151 6e-14 BLAST
PDB:2DKP|A 163 196 1e-5 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000204876
AA Change: V44A

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145336
Gene: ENSMUSG00000030231
AA Change: V44A

DomainStartEndE-ValueType
PH 62 162 8.6e-20 SMART
Blast:PH 483 517 3e-8 BLAST
low complexity region 518 527 N/A INTRINSIC
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adgrb3 A T 1: 25,111,748 F1135I probably damaging Het
Arfgef3 A T 10: 18,600,600 F1490L probably damaging Het
Begain A G 12: 109,034,123 Y446H probably damaging Het
Cdh15 A G 8: 122,864,676 H517R probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dip2b C T 15: 100,186,301 T935M probably damaging Het
Eif2s2 T C 2: 154,888,270 T36A probably benign Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbxo10 T C 4: 45,048,470 Y555C probably damaging Het
Fpr2 C T 17: 17,893,753 T337I probably benign Het
Frem3 A T 8: 80,611,357 Q93L probably benign Het
Gapdh A G 6: 125,163,182 V119A possibly damaging Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Hkdc1 T C 10: 62,391,372 I769V probably benign Het
Ifne T C 4: 88,879,601 *193W probably null Het
Katna1 T C 10: 7,738,830 V32A probably damaging Het
Nup107 T C 10: 117,761,332 I673V probably benign Het
Nup188 T A 2: 30,322,129 probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1510 G A 14: 52,410,308 A188V probably damaging Het
Olfr330 G T 11: 58,529,801 P62T probably damaging Het
Pcdhb5 T A 18: 37,320,752 S62T probably benign Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Ptprcap A G 19: 4,156,224 E102G probably benign Het
Ptprs A G 17: 56,426,404 V804A possibly damaging Het
Rab35 C A 5: 115,637,764 S34* probably null Het
Slco6d1 T A 1: 98,507,574 Y671* probably null Het
Sostdc1 A G 12: 36,317,166 I114V probably damaging Het
Tecta A G 9: 42,373,233 F852S possibly damaging Het
Tmem179 T C 12: 112,503,303 E21G probably benign Het
Tmem2 A G 19: 21,815,489 Q703R probably benign Het
Usp17la T A 7: 104,860,690 H167Q probably benign Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr17 A G 8: 54,664,964 probably null Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp985 A G 4: 147,584,079 D468G probably benign Het
Other mutations in Plekha5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Plekha5 APN 6 140570096 splice site probably benign
IGL00908:Plekha5 APN 6 140550930 missense probably damaging 1.00
IGL01346:Plekha5 APN 6 140534566 splice site probably benign
IGL01380:Plekha5 APN 6 140570316 splice site probably benign
IGL01406:Plekha5 APN 6 140572950 missense probably damaging 0.99
IGL01408:Plekha5 APN 6 140570316 splice site probably benign
IGL01688:Plekha5 APN 6 140569389 missense probably damaging 0.98
IGL01719:Plekha5 APN 6 140570129 missense probably damaging 1.00
IGL01926:Plekha5 APN 6 140525916 missense probably benign 0.12
IGL01936:Plekha5 APN 6 140524895 missense probably damaging 1.00
IGL02326:Plekha5 APN 6 140583850 nonsense probably null
IGL02544:Plekha5 APN 6 140589728 missense possibly damaging 0.78
IGL02573:Plekha5 APN 6 140582016 missense probably damaging 1.00
IGL02704:Plekha5 APN 6 140543866 missense probably damaging 1.00
IGL02959:Plekha5 APN 6 140544178 missense probably damaging 1.00
Doubletime UTSW 6 140525929 nonsense probably null
R0067:Plekha5 UTSW 6 140524903 missense probably damaging 1.00
R0067:Plekha5 UTSW 6 140524903 missense probably damaging 1.00
R0095:Plekha5 UTSW 6 140528597 missense probably damaging 1.00
R0095:Plekha5 UTSW 6 140528597 missense probably damaging 1.00
R0105:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0107:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0359:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0360:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0362:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0363:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0364:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0365:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0833:Plekha5 UTSW 6 140589634 splice site probably benign
R0835:Plekha5 UTSW 6 140568850 nonsense probably null
R0836:Plekha5 UTSW 6 140589634 splice site probably benign
R0944:Plekha5 UTSW 6 140570196 splice site probably benign
R2015:Plekha5 UTSW 6 140534564 critical splice donor site probably null
R2043:Plekha5 UTSW 6 140552804 splice site probably benign
R2086:Plekha5 UTSW 6 140570318 splice site probably null
R2102:Plekha5 UTSW 6 140572877 missense probably damaging 1.00
R2109:Plekha5 UTSW 6 140424216 missense possibly damaging 0.56
R2135:Plekha5 UTSW 6 140580499 missense possibly damaging 0.66
R2150:Plekha5 UTSW 6 140570403 missense probably damaging 1.00
R2211:Plekha5 UTSW 6 140525861 missense possibly damaging 0.56
R2414:Plekha5 UTSW 6 140550856 missense probably damaging 1.00
R2915:Plekha5 UTSW 6 140589199 missense probably damaging 0.96
R3120:Plekha5 UTSW 6 140591641 missense probably benign 0.00
R3924:Plekha5 UTSW 6 140570379 missense possibly damaging 0.78
R4049:Plekha5 UTSW 6 140583871 missense probably damaging 1.00
R4056:Plekha5 UTSW 6 140589232 missense possibly damaging 0.46
R4077:Plekha5 UTSW 6 140555921 intron probably null
R4320:Plekha5 UTSW 6 140543817 missense possibly damaging 0.68
R4343:Plekha5 UTSW 6 140556054 missense probably damaging 0.99
R4359:Plekha5 UTSW 6 140591688 missense probably benign 0.07
R4377:Plekha5 UTSW 6 140579465 missense probably damaging 1.00
R4533:Plekha5 UTSW 6 140570331 missense probably damaging 1.00
R4623:Plekha5 UTSW 6 140551186 missense probably damaging 0.98
R4672:Plekha5 UTSW 6 140524929 missense probably damaging 0.98
R4871:Plekha5 UTSW 6 140525910 missense probably damaging 1.00
R4903:Plekha5 UTSW 6 140586367 missense probably damaging 1.00
R5121:Plekha5 UTSW 6 140579474 missense probably damaging 1.00
R5156:Plekha5 UTSW 6 140426528 missense probably damaging 1.00
R5376:Plekha5 UTSW 6 140551144 missense probably damaging 1.00
R5445:Plekha5 UTSW 6 140552733 nonsense probably null
R5753:Plekha5 UTSW 6 140537004 critical splice acceptor site probably null
R5836:Plekha5 UTSW 6 140426524 missense probably damaging 1.00
R5972:Plekha5 UTSW 6 140572913 missense possibly damaging 0.78
R6196:Plekha5 UTSW 6 140579453 missense probably benign 0.28
R6254:Plekha5 UTSW 6 140586436 missense probably damaging 1.00
R6501:Plekha5 UTSW 6 140525929 nonsense probably null
R6620:Plekha5 UTSW 6 140572875 missense probably damaging 1.00
R6663:Plekha5 UTSW 6 140577290 missense probably damaging 1.00
R6823:Plekha5 UTSW 6 140525858 missense probably benign 0.16
R6992:Plekha5 UTSW 6 140543908 missense probably damaging 1.00
R7196:Plekha5 UTSW 6 140543922 missense possibly damaging 0.83
R7487:Plekha5 UTSW 6 140570333 missense probably benign 0.25
X0027:Plekha5 UTSW 6 140424423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTATTCTGTTGAATCAGCTAAAC -3'
(R):5'- CTAGTCCCTAAACATGCTCGG -3'

Sequencing Primer
(F):5'- GTCTTGAAATCACATTTCCTTGTG -3'
(R):5'- GGTCATCAACTTCTCAGACGGAG -3'
Posted On2015-07-21