Incidental Mutation 'R4480:Sostdc1'
ID 331440
Institutional Source Beutler Lab
Gene Symbol Sostdc1
Ensembl Gene ENSMUSG00000036169
Gene Name sclerostin domain containing 1
Synonyms ectodin, Sostl, Wise, USAG-1
MMRRC Submission 041737-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.499) question?
Stock # R4480 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 36364168-36368451 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36367165 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 114 (I114V)
Ref Sequence ENSEMBL: ENSMUSP00000040230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041407]
AlphaFold Q9CQN4
Predicted Effect probably damaging
Transcript: ENSMUST00000041407
AA Change: I114V

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040230
Gene: ENSMUSG00000036169
AA Change: I114V

DomainStartEndE-ValueType
Pfam:Sclerostin 6 206 2.1e-112 PFAM
Pfam:DAN 47 168 3.2e-17 PFAM
Pfam:Cys_knot 72 185 1.2e-7 PFAM
Meta Mutation Damage Score 0.1807 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the sclerostin family and encodes an N-glycosylated, secreted protein with a C-terminal cystine knot-like domain. This protein functions as a bone morphogenetic protein (BMP) antagonist. Specifically, it directly associates with BMPs, prohibiting them from binding their receptors, thereby regulating BMP signaling during cellular proliferation, differentiation, and programmed cell death. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene cause variable defects in many aspects of tooth development, including tooth number, size and cusp pattern. Observed phenotypes may include cranial and palatal defects, neonatal death, altered trigeminal ganglion morphology, and resistance to cisplatin-induced renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 45,654,663 (GRCm39) T553A possibly damaging Het
Adgrb3 A T 1: 25,150,829 (GRCm39) F1135I probably damaging Het
Arfgef3 A T 10: 18,476,348 (GRCm39) F1490L probably damaging Het
Begain A G 12: 109,000,049 (GRCm39) Y446H probably damaging Het
Cdh15 A G 8: 123,591,415 (GRCm39) H517R probably benign Het
Cemip2 A G 19: 21,792,853 (GRCm39) Q703R probably benign Het
D130040H23Rik C A 8: 69,755,155 (GRCm39) H187N possibly damaging Het
Dip2b C T 15: 100,084,182 (GRCm39) T935M probably damaging Het
Eif2s2 T C 2: 154,730,190 (GRCm39) T36A probably benign Het
Eif4g1 G T 16: 20,497,593 (GRCm39) probably benign Het
Fat3 G A 9: 15,909,567 (GRCm39) S2145F probably damaging Het
Fbxo10 T C 4: 45,048,470 (GRCm39) Y555C probably damaging Het
Fpr2 C T 17: 18,114,015 (GRCm39) T337I probably benign Het
Frem3 A T 8: 81,337,986 (GRCm39) Q93L probably benign Het
Gapdh A G 6: 125,140,145 (GRCm39) V119A possibly damaging Het
Gm3159 T C 14: 4,398,584 (GRCm38) Y92H probably damaging Het
Hkdc1 T C 10: 62,227,151 (GRCm39) I769V probably benign Het
Ifne T C 4: 88,797,838 (GRCm39) *193W probably null Het
Katna1 T C 10: 7,614,594 (GRCm39) V32A probably damaging Het
Nup107 T C 10: 117,597,237 (GRCm39) I673V probably benign Het
Nup188 T A 2: 30,212,141 (GRCm39) probably benign Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Or10g1 G A 14: 52,647,765 (GRCm39) A188V probably damaging Het
Or2t48 G T 11: 58,420,627 (GRCm39) P62T probably damaging Het
Pcdhb5 T A 18: 37,453,805 (GRCm39) S62T probably benign Het
Plekha5 T C 6: 140,472,205 (GRCm39) V44A probably damaging Het
Psg18 C T 7: 18,084,787 (GRCm39) S103N probably benign Het
Ptprcap A G 19: 4,206,223 (GRCm39) E102G probably benign Het
Ptprs A G 17: 56,733,404 (GRCm39) V804A possibly damaging Het
Rab35 C A 5: 115,775,823 (GRCm39) S34* probably null Het
Slco6d1 T A 1: 98,435,299 (GRCm39) Y671* probably null Het
Tecta A G 9: 42,284,529 (GRCm39) F852S possibly damaging Het
Tmem179 T C 12: 112,469,737 (GRCm39) E21G probably benign Het
Usp17la T A 7: 104,509,897 (GRCm39) H167Q probably benign Het
Vps8 A T 16: 21,363,986 (GRCm39) probably benign Het
Wdr17 A G 8: 55,117,999 (GRCm39) probably null Het
Wdr73 T C 7: 80,542,969 (GRCm39) E213G probably benign Het
Zfp985 A G 4: 147,668,536 (GRCm39) D468G probably benign Het
Other mutations in Sostdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01954:Sostdc1 APN 12 36,367,121 (GRCm39) missense probably damaging 1.00
R0588:Sostdc1 UTSW 12 36,367,020 (GRCm39) splice site probably benign
R0671:Sostdc1 UTSW 12 36,367,340 (GRCm39) missense probably damaging 0.99
R2184:Sostdc1 UTSW 12 36,367,295 (GRCm39) missense probably damaging 0.97
R4320:Sostdc1 UTSW 12 36,367,419 (GRCm39) missense probably benign 0.04
R5511:Sostdc1 UTSW 12 36,367,165 (GRCm39) missense probably damaging 1.00
R5589:Sostdc1 UTSW 12 36,367,246 (GRCm39) nonsense probably null
R5665:Sostdc1 UTSW 12 36,364,407 (GRCm39) missense probably benign 0.39
R6453:Sostdc1 UTSW 12 36,364,407 (GRCm39) missense probably benign 0.39
R6752:Sostdc1 UTSW 12 36,364,411 (GRCm39) missense probably benign 0.00
R7232:Sostdc1 UTSW 12 36,367,310 (GRCm39) missense possibly damaging 0.87
R8810:Sostdc1 UTSW 12 36,367,229 (GRCm39) missense possibly damaging 0.88
R9019:Sostdc1 UTSW 12 36,364,431 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GTCCCTGATGCAGTTCTGTC -3'
(R):5'- AGCTCAGACTGTGCTTGCTG -3'

Sequencing Primer
(F):5'- CCTGTTTCCTGCAGGTCGAG -3'
(R):5'- ACACGCTTTCAAAGTTGTGGC -3'
Posted On 2015-07-21