Incidental Mutation 'R0099:Ica1'
ID33147
Institutional Source Beutler Lab
Gene Symbol Ica1
Ensembl Gene ENSMUSG00000062995
Gene Nameislet cell autoantigen 1
SynonymsICA69, 69kDa
MMRRC Submission 038385-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R0099 (G1)
Quality Score124
Status Validated (trace)
Chromosome6
Chromosomal Location8630527-8778488 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 8749778 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038403] [ENSMUST00000115518] [ENSMUST00000115519] [ENSMUST00000115520] [ENSMUST00000126039] [ENSMUST00000151758] [ENSMUST00000153390] [ENSMUST00000156695]
Predicted Effect probably benign
Transcript: ENSMUST00000038403
SMART Domains Protein: ENSMUSP00000040062
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
ICA69 260 478 1.25e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115518
SMART Domains Protein: ENSMUSP00000111180
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115519
SMART Domains Protein: ENSMUSP00000111181
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
ICA69 260 465 4.01e-83 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115520
SMART Domains Protein: ENSMUSP00000111182
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
ICA69 260 478 1.25e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126039
SMART Domains Protein: ENSMUSP00000118010
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Pfam:Arfaptin 21 73 3.6e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135113
Predicted Effect probably benign
Transcript: ENSMUST00000151758
Predicted Effect probably benign
Transcript: ENSMUST00000153390
SMART Domains Protein: ENSMUSP00000117734
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156695
SMART Domains Protein: ENSMUSP00000138459
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
Pfam:ICA69 260 301 4.1e-12 PFAM
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an arfaptin homology domain that is found both in the cytosol and as membrane-bound form on the Golgi complex and immature secretory granules. This protein is believed to be an autoantigen in insulin-dependent diabetes mellitus and primary Sjogren's syndrome. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous mutation of this gene results in diabetes and spontaneous lethality at 4-5 months of age on a NOD background, however mice on a 129/Sv background are normal. Onset of diabetes starts 4 weeks later than wild-type NOD mice and mutants are resistant to cyclophospamide-accelerated diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930018M24Rik C T 14: 50,896,722 probably benign Het
Acad10 A C 5: 121,621,290 D1043E probably damaging Het
Adamtsl4 C T 3: 95,684,139 G173R probably benign Het
Astn1 G T 1: 158,502,151 S192I probably damaging Het
Atg2a T A 19: 6,252,789 V1010E probably damaging Het
C130079G13Rik A C 3: 59,936,435 K183N probably benign Het
Col11a2 A G 17: 34,049,674 E311G probably damaging Het
Col4a3 A C 1: 82,717,993 E1638A probably benign Het
Cstf2t A G 19: 31,083,831 R256G probably benign Het
Cyp4a12a T C 4: 115,326,672 L225P probably damaging Het
Diexf A G 1: 193,128,470 L75P probably damaging Het
Dnah5 G A 15: 28,239,934 R479H probably damaging Het
Dsg3 A G 18: 20,540,022 I917V probably benign Het
Fam76a G T 4: 132,910,787 probably benign Het
Fras1 T A 5: 96,614,917 probably null Het
Gli1 A G 10: 127,336,006 V293A probably damaging Het
Gm10782 T A 13: 56,363,143 noncoding transcript Het
Greb1l A G 18: 10,509,158 E490G probably damaging Het
Hydin G A 8: 110,589,561 G4362R probably damaging Het
Ikzf4 T A 10: 128,634,197 I485F probably damaging Het
Irf5 A G 6: 29,533,967 T34A probably damaging Het
Krt81 A T 15: 101,463,521 C59* probably null Het
Kynu T A 2: 43,629,053 probably null Het
Ly6g6c T C 17: 35,068,915 V61A probably damaging Het
Manea A C 4: 26,328,104 I312M probably damaging Het
Micall1 G T 15: 79,131,901 probably benign Het
Mthfs A T 9: 89,226,163 probably benign Het
Myh4 A G 11: 67,259,347 T1877A probably benign Het
Myo3a T C 2: 22,245,598 I92T probably benign Het
Nepn A G 10: 52,401,085 S306G probably damaging Het
Nol8 T C 13: 49,672,689 V995A probably benign Het
Olfr1453 A G 19: 13,027,801 F176S probably damaging Het
Olfr1458 T A 19: 13,103,140 T49S probably benign Het
Olfr160 A T 9: 37,711,454 V275E probably damaging Het
Olfr967 A G 9: 39,750,661 I92V possibly damaging Het
Pde1a T A 2: 79,868,313 probably null Het
Phf14 A G 6: 11,987,697 probably benign Het
Plekhh2 C T 17: 84,591,672 Q1026* probably null Het
Polr2b T A 5: 77,320,950 probably benign Het
Ppp1r36 G T 12: 76,436,282 probably null Het
Prdm14 A T 1: 13,118,945 C392S probably damaging Het
Rabgap1l A G 1: 160,682,116 S436P possibly damaging Het
Rfc2 A T 5: 134,595,281 probably null Het
Rfx4 A T 10: 84,894,304 M437L probably benign Het
Rgs17 T A 10: 5,842,583 R74S probably benign Het
Rnf139 C A 15: 58,899,415 L430I probably damaging Het
Sgsm1 C A 5: 113,274,360 probably benign Het
Skint6 T A 4: 112,811,501 T1126S possibly damaging Het
Slc15a2 T C 16: 36,753,036 E602G probably damaging Het
Stpg2 T C 3: 139,243,193 probably benign Het
Sycp2l T C 13: 41,129,525 probably benign Het
Tlr11 A T 14: 50,360,818 N87I probably benign Het
Tril A G 6: 53,818,363 F625L probably damaging Het
Ube3c T A 5: 29,607,064 V434E probably damaging Het
Usp34 G A 11: 23,363,111 G533R probably damaging Het
Zfp93 G T 7: 24,275,475 R295L probably benign Het
Other mutations in Ica1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Ica1 APN 6 8653514 missense probably benign
IGL02248:Ica1 APN 6 8758387 utr 5 prime probably benign
IGL02547:Ica1 APN 6 8670691 splice site probably null
round_heels UTSW 6 8630799 critical splice acceptor site probably null
R0244:Ica1 UTSW 6 8653632 nonsense probably null
R0479:Ica1 UTSW 6 8754627 missense probably damaging 1.00
R0479:Ica1 UTSW 6 8754683 missense probably damaging 1.00
R0628:Ica1 UTSW 6 8644256 splice site probably benign
R0826:Ica1 UTSW 6 8667375 intron probably benign
R1186:Ica1 UTSW 6 8672326 missense probably damaging 1.00
R1384:Ica1 UTSW 6 8742262 nonsense probably null
R1957:Ica1 UTSW 6 8749736 missense possibly damaging 0.85
R2431:Ica1 UTSW 6 8658265 missense probably benign
R3722:Ica1 UTSW 6 8659021 intron probably benign
R4224:Ica1 UTSW 6 8659960 missense probably benign 0.11
R4777:Ica1 UTSW 6 8644145 missense probably benign
R5633:Ica1 UTSW 6 8667257 missense possibly damaging 0.73
R5786:Ica1 UTSW 6 8672391 missense possibly damaging 0.50
R6033:Ica1 UTSW 6 8630799 critical splice acceptor site probably null
R6033:Ica1 UTSW 6 8630799 critical splice acceptor site probably null
R6053:Ica1 UTSW 6 8630783 missense probably benign 0.01
R6221:Ica1 UTSW 6 8644181 missense possibly damaging 0.82
R6794:Ica1 UTSW 6 8653659 missense probably benign 0.00
R6819:Ica1 UTSW 6 8742288 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCGAGACCTTCTTCCCACCTGAAATAG -3'
(R):5'- TGAAGGGCACTGATCATTCGCTG -3'

Sequencing Primer
(F):5'- CCTGAAATAGCAAAGATGTGTCC -3'
(R):5'- CGCTGGATGTCTCAGTACAGAG -3'
Posted On2013-05-09