Mutagenetix > Incidental Mutation

Incidental Mutation 'R4483:Dbi'

331485

Institutional Source

Beutler Lab

Gene Symbol

Dbi

Ensembl Gene

ENSMUSG00000026385

Gene Name

diazepam binding inhibitor

Synonyms

endozepine, Acbp, diazepam-binding inhibitor, EP

MMRRC Submission

041739-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.249) question?

Stock #

R4483 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

120041010-120048808 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 120048535 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 37 (I37K)

Ref Sequence

ENSEMBL: ENSMUSP00000114705 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027634] [ENSMUST00000027637] [ENSMUST00000056038] [ENSMUST00000112644] [ENSMUST00000112648] [ENSMUST00000132118] [ENSMUST00000151708]

AlphaFold

P31786

Predicted Effect

probably benign
Transcript: ENSMUST00000027634

SMART Domains

Protein: ENSMUSP00000027634
Gene: ENSMUSG00000026385

Domain	Start	End	E-Value	Type
Pfam:ACBP	3	83	1.2e-32	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000027637

SMART Domains

Protein: ENSMUSP00000027637
Gene: ENSMUSG00000026388

Domain	Start	End	E-Value	Type
Pfam:DUF2340	8	93	3.7e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000056038

SMART Domains

Protein: ENSMUSP00000053335
Gene: ENSMUSG00000026388

Domain	Start	End	E-Value	Type
Pfam:DUF2340	8	93	3.7e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000112644

SMART Domains

Protein: ENSMUSP00000108263
Gene: ENSMUSG00000026388

Domain	Start	End	E-Value	Type
Pfam:DUF2340	8	126	1.4e-43	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000112648

SMART Domains

Protein: ENSMUSP00000108267
Gene: ENSMUSG00000026385

Domain	Start	End	E-Value	Type
Pfam:ACBP	1	62	2.6e-27	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128408

Predicted Effect

probably benign
Transcript: ENSMUST00000132118

SMART Domains

Protein: ENSMUSP00000138014
Gene: ENSMUSG00000026385

Domain	Start	End	E-Value	Type
Pfam:ACBP	2	70	7.9e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000151708
AA Change: I37K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000114705
Gene: ENSMUSG00000026385
AA Change: I37K

Domain	Start	End	E-Value	Type
Pfam:ACBP	50	134	1.3e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135937

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149628

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes diazepam binding inhibitor, a protein that is regulated by hormones and is involved in lipid metabolism and the displacement of beta-carbolines and benzodiazepines, which modulate signal transduction at type A gamma-aminobutyric acid receptors located in brain synapses. The protein is conserved from yeast to mammals, with the most highly conserved domain consisting of seven contiguous residues that constitute the hydrophobic binding site for medium- and long-chain acyl-Coenzyme A esters. Diazepam binding inhibitor is also known to mediate the feedback regulation of pancreatic secretion and the postprandial release of cholecystokinin, in addition to its role as a mediator in corticotropin-dependent adrenal steroidogenesis. Three pseudogenes located on chromosomes 6, 8 and 16 have been identified. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal fur and skin morphology at P16 and impaired metabolic changes at weaning with reduced growth and hepatic cholesterol synthesis. Mice homozygous for a different knock-out allele complete exhibit embryonic lethality around implantation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	C	T	13: 81,567,349 (GRCm39)	G5275S	probably benign	Het
Akap11	A	G	14: 78,747,699 (GRCm39)	S1563P	probably damaging	Het
Ankrd50	A	G	3: 38,511,680 (GRCm39)	V229A	probably damaging	Het
AW112010	A	G	19: 11,027,757 (GRCm39)		noncoding transcript	Het
Ccdc158	A	G	5: 92,781,187 (GRCm39)	S873P	probably benign	Het
Cep350	A	G	1: 155,802,214 (GRCm39)	V1104A	probably benign	Het
Chil4	G	A	3: 106,121,678 (GRCm39)	A57V	probably damaging	Het
Cpa5	A	G	6: 30,624,625 (GRCm39)	E155G	probably damaging	Het
Ctsq	T	C	13: 61,186,726 (GRCm39)	I93V	probably benign	Het
Defa35	T	C	8: 21,555,208 (GRCm39)	S43P	probably damaging	Het
Fance	T	A	17: 28,534,781 (GRCm39)		probably benign	Het
Fbxl6	A	G	15: 76,422,129 (GRCm39)	L180P	probably damaging	Het
Fkbpl	T	C	17: 34,865,269 (GRCm39)	F346L	probably damaging	Het
Gm11735	C	A	11: 116,632,101 (GRCm39)		noncoding transcript	Het
Gm28042	T	C	2: 119,866,321 (GRCm39)	I373T	possibly damaging	Het
Golga4	T	C	9: 118,343,254 (GRCm39)	S27P	probably damaging	Het
Gstm1	C	T	3: 107,923,834 (GRCm39)		probably null	Het
Lama3	T	A	18: 12,682,310 (GRCm39)	I1092K	probably benign	Het
Med15	A	T	16: 17,489,428 (GRCm39)		probably benign	Het
Nlrp6	A	G	7: 140,501,694 (GRCm39)	D87G	probably damaging	Het
Parp11	A	G	6: 127,448,568 (GRCm39)	T62A	probably benign	Het
Pcnt	A	G	10: 76,237,317 (GRCm39)	L1323S	probably damaging	Het
Ppp2r1a	C	T	17: 21,176,072 (GRCm39)	T98I	probably benign	Het
Pramel11	T	A	4: 143,622,410 (GRCm39)	Y315F	probably damaging	Het
Prl7a2	T	A	13: 27,844,930 (GRCm39)	H152L	possibly damaging	Het
Rnf145	T	C	11: 44,455,104 (GRCm39)	S662P	probably benign	Het
Rpl31-ps17	C	T	12: 54,748,397 (GRCm39)		noncoding transcript	Het
Tnfaip3	A	T	10: 18,887,375 (GRCm39)	M50K	probably damaging	Het
Txlnb	T	TTA	10: 17,714,745 (GRCm39)		probably null	Het
Usp9x	A	G	X: 12,987,687 (GRCm39)	D638G	possibly damaging	Het
Vmn1r30	A	T	6: 58,412,118 (GRCm39)	V238E	probably damaging	Het
Zfp507	A	G	7: 35,487,141 (GRCm39)		probably null	Het
Zfp532	G	T	18: 65,789,636 (GRCm39)	W1025L	probably benign	Het

Other mutations in Dbi

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01092:Dbi	APN	1	120,041,207 (GRCm39)	missense	probably benign	0.06
PIT4581001:Dbi	UTSW	1	120,047,642 (GRCm39)	missense	probably damaging	0.96
R2964:Dbi	UTSW	1	120,047,846 (GRCm39)	intron	probably benign
R5935:Dbi	UTSW	1	120,048,583 (GRCm39)	missense	probably benign	0.41
R7357:Dbi	UTSW	1	120,047,623 (GRCm39)	critical splice donor site	probably null
R8347:Dbi	UTSW	1	120,048,550 (GRCm39)	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- TCTCTTCTGTACAGGGGCAG -3'
(R):5'- GCGCTCTGTGACTTGATTGC -3'

Sequencing Primer
(F):5'- TTCAGCCAGGGCCTGTATGAG -3'
(R):5'- GACTTGATTGCTGCTGCTTC -3'

Posted On

2015-07-21