Incidental Mutation 'R4485:Ccdc129'
ID331573
Institutional Source Beutler Lab
Gene Symbol Ccdc129
Ensembl Gene ENSMUSG00000037973
Gene Namecoiled-coil domain containing 129
SynonymsD530004J12Rik
MMRRC Submission 041741-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.023) question?
Stock #R4485 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location55836895-55978735 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55887066 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 126 (T126A)
Ref Sequence ENSEMBL: ENSMUSP00000045332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044729]
Predicted Effect probably benign
Transcript: ENSMUST00000044729
AA Change: T126A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000045332
Gene: ENSMUSG00000037973
AA Change: T126A

DomainStartEndE-ValueType
KRAP_IP3R_bind 112 264 2.99e-82 SMART
low complexity region 326 334 N/A INTRINSIC
low complexity region 432 442 N/A INTRINSIC
low complexity region 477 496 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
Pfam:SSFA2_C 806 916 3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169699
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agxt2 A T 15: 10,378,882 I190L possibly damaging Het
Ahnak2 A G 12: 112,779,767 probably benign Het
Apol7b C A 15: 77,423,666 V210L probably benign Het
Banf2 C T 2: 144,073,852 T71M probably damaging Het
Cacna1s A G 1: 136,076,852 D130G probably damaging Het
Capn8 T C 1: 182,598,741 F214L possibly damaging Het
Cdk5rap2 A T 4: 70,239,283 probably null Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cpb1 T G 3: 20,249,701 M400L probably benign Het
Eps15l1 A T 8: 72,399,687 I52N possibly damaging Het
Gbp9 C G 5: 105,083,808 G304A probably damaging Het
Gm14226 G A 2: 155,025,271 V383I probably benign Het
Gm8251 A G 1: 44,060,123 L605S probably benign Het
Npm2 A T 14: 70,648,309 V152D possibly damaging Het
Nsd1 T C 13: 55,245,621 V345A probably benign Het
Olfr1461 T C 19: 13,165,491 V159A possibly damaging Het
Olfr1474 T C 19: 13,471,555 I195T probably benign Het
Olfr482 T C 7: 108,095,015 D185G probably benign Het
Olfr679 T A 7: 105,086,601 V295D probably damaging Het
Otof T A 5: 30,375,000 H1601L possibly damaging Het
Plat G A 8: 22,772,212 S84N probably benign Het
Prss30 T C 17: 23,973,156 D224G probably damaging Het
Psg25 C A 7: 18,526,278 V232F probably damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Pus7l G T 15: 94,523,490 H646Q probably benign Het
Ryr1 C T 7: 29,090,156 S1511N probably damaging Het
Slc16a1 A G 3: 104,655,478 K413R probably benign Het
Snrnp48 T A 13: 38,216,328 M137K probably benign Het
Tecta T A 9: 42,337,274 H1944L possibly damaging Het
Tmem145 A G 7: 25,307,162 E65G possibly damaging Het
Vmn2r87 A T 10: 130,479,809 Y129* probably null Het
Wdr7 A G 18: 63,777,550 H671R possibly damaging Het
Zfp219 A G 14: 52,007,384 V518A probably damaging Het
Zfp472 T C 17: 32,977,568 W206R possibly damaging Het
Other mutations in Ccdc129
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ccdc129 APN 6 55968037 missense possibly damaging 0.90
IGL01317:Ccdc129 APN 6 55967805 missense possibly damaging 0.77
IGL01390:Ccdc129 APN 6 55897998 missense probably benign 0.41
IGL01696:Ccdc129 APN 6 55897695 missense probably benign 0.40
IGL01941:Ccdc129 APN 6 55968045 missense probably benign
IGL01967:Ccdc129 APN 6 55897911 missense probably damaging 0.99
IGL02071:Ccdc129 APN 6 55967725 nonsense probably null
IGL02232:Ccdc129 APN 6 55967937 missense unknown
IGL02268:Ccdc129 APN 6 55884688 splice site probably benign
IGL02440:Ccdc129 APN 6 55884728 missense possibly damaging 0.95
IGL02614:Ccdc129 APN 6 55968277 missense probably damaging 0.99
IGL02626:Ccdc129 APN 6 55968646 missense probably benign 0.03
IGL02674:Ccdc129 APN 6 55897928 missense probably benign 0.04
IGL02836:Ccdc129 APN 6 55898090 missense probably damaging 1.00
IGL02884:Ccdc129 APN 6 55874354 splice site probably null
IGL02889:Ccdc129 APN 6 55901458 missense possibly damaging 0.46
IGL03103:Ccdc129 APN 6 55968159 missense possibly damaging 0.59
IGL03117:Ccdc129 APN 6 55898129 missense probably benign 0.25
IGL03343:Ccdc129 APN 6 55968584 missense probably damaging 1.00
R0054:Ccdc129 UTSW 6 55872472 utr 5 prime probably benign
R0200:Ccdc129 UTSW 6 55897956 missense probably benign 0.10
R0245:Ccdc129 UTSW 6 55898007 missense probably damaging 1.00
R0320:Ccdc129 UTSW 6 55976447 missense probably damaging 1.00
R0326:Ccdc129 UTSW 6 55898243 missense possibly damaging 0.61
R0357:Ccdc129 UTSW 6 55968034 missense probably benign 0.13
R1109:Ccdc129 UTSW 6 55968260 missense probably damaging 1.00
R1118:Ccdc129 UTSW 6 55889170 missense probably damaging 1.00
R1119:Ccdc129 UTSW 6 55889170 missense probably damaging 1.00
R1462:Ccdc129 UTSW 6 55975664 missense probably damaging 1.00
R1462:Ccdc129 UTSW 6 55975664 missense probably damaging 1.00
R1588:Ccdc129 UTSW 6 55978503 missense possibly damaging 0.72
R1678:Ccdc129 UTSW 6 55968514 missense probably benign 0.35
R1680:Ccdc129 UTSW 6 55968766 missense probably damaging 1.00
R1728:Ccdc129 UTSW 6 55968541 missense probably benign 0.01
R1729:Ccdc129 UTSW 6 55968541 missense probably benign 0.01
R1737:Ccdc129 UTSW 6 55968304 missense probably damaging 1.00
R1771:Ccdc129 UTSW 6 55898147 missense probably benign 0.40
R1784:Ccdc129 UTSW 6 55968541 missense probably benign 0.01
R1936:Ccdc129 UTSW 6 55897681 missense probably damaging 1.00
R1995:Ccdc129 UTSW 6 55968709 missense probably benign 0.03
R2037:Ccdc129 UTSW 6 55897875 missense probably benign 0.00
R2137:Ccdc129 UTSW 6 55889189 missense probably damaging 1.00
R2190:Ccdc129 UTSW 6 55897700 missense possibly damaging 0.87
R2191:Ccdc129 UTSW 6 55967719 missense probably benign 0.06
R2234:Ccdc129 UTSW 6 55897812 missense possibly damaging 0.67
R2235:Ccdc129 UTSW 6 55897812 missense possibly damaging 0.67
R3793:Ccdc129 UTSW 6 55975603 missense possibly damaging 0.80
R3923:Ccdc129 UTSW 6 55968060 missense probably benign 0.19
R3959:Ccdc129 UTSW 6 55897740 missense probably benign
R4332:Ccdc129 UTSW 6 55968235 missense possibly damaging 0.95
R4688:Ccdc129 UTSW 6 55967147 splice site probably null
R4916:Ccdc129 UTSW 6 55978190 missense possibly damaging 0.77
R5201:Ccdc129 UTSW 6 55968006 missense probably benign 0.03
R5383:Ccdc129 UTSW 6 55978290 missense probably benign 0.38
R5450:Ccdc129 UTSW 6 55968811 critical splice donor site probably null
R5542:Ccdc129 UTSW 6 55978395 missense probably damaging 0.99
R5819:Ccdc129 UTSW 6 55897891 missense probably benign 0.18
R5935:Ccdc129 UTSW 6 55897769 nonsense probably null
R6034:Ccdc129 UTSW 6 55967681 missense possibly damaging 0.94
R6034:Ccdc129 UTSW 6 55967681 missense possibly damaging 0.94
R6209:Ccdc129 UTSW 6 55874321 missense probably damaging 1.00
R6246:Ccdc129 UTSW 6 55967672 missense probably damaging 1.00
R6463:Ccdc129 UTSW 6 55968678 missense probably benign 0.17
R6490:Ccdc129 UTSW 6 55976420 missense probably damaging 1.00
R6948:Ccdc129 UTSW 6 55978485 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACTGTGGGGTTATTAGAAACAGG -3'
(R):5'- GACAGACAGTTAATCTCCTTTCCAAC -3'

Sequencing Primer
(F):5'- CAGGAGGAAACAAAAATGATTTCTTG -3'
(R):5'- CAACTTCACTGCCTTTTTAAATGTAC -3'
Posted On2015-07-21