Incidental Mutation 'R4486:Bud23'
ID331607
Institutional Source Beutler Lab
Gene Symbol Bud23
Ensembl Gene ENSMUSG00000005378
Gene NameBUD23, rRNA methyltransferase and ribosome maturation factor
Synonyms1110003N24Rik, Wbscr22
MMRRC Submission 041742-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4486 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location135052957-135064959 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 135063925 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071263] [ENSMUST00000071677] [ENSMUST00000085984] [ENSMUST00000111205] [ENSMUST00000111205] [ENSMUST00000141309] [ENSMUST00000141309] [ENSMUST00000148549] [ENSMUST00000201554]
Predicted Effect probably benign
Transcript: ENSMUST00000071263
SMART Domains Protein: ENSMUSP00000094318
Gene: ENSMUSG00000061118

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
DnaJ 41 99 8.75e-19 SMART
low complexity region 123 141 N/A INTRINSIC
low complexity region 167 187 N/A INTRINSIC
low complexity region 204 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071677
SMART Domains Protein: ENSMUSP00000071600
Gene: ENSMUSG00000005378

DomainStartEndE-ValueType
Pfam:Methyltransf_11 36 120 4.7e-13 PFAM
Pfam:WBS_methylT 182 258 9.6e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000085984
SMART Domains Protein: ENSMUSP00000083146
Gene: ENSMUSG00000005378

DomainStartEndE-ValueType
Pfam:Methyltransf_11 58 143 5.3e-11 PFAM
Pfam:WBS_methylT 204 279 1.1e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111205
SMART Domains Protein: ENSMUSP00000106836
Gene: ENSMUSG00000005378

DomainStartEndE-ValueType
Pfam:Methyltransf_11 58 142 1.1e-12 PFAM
Pfam:WBS_methylT 168 245 1.3e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111205
SMART Domains Protein: ENSMUSP00000106836
Gene: ENSMUSG00000005378

DomainStartEndE-ValueType
Pfam:Methyltransf_11 58 142 1.1e-12 PFAM
Pfam:WBS_methylT 168 245 1.3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129013
Predicted Effect probably null
Transcript: ENSMUST00000141309
Predicted Effect probably null
Transcript: ENSMUST00000141309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144891
Predicted Effect probably null
Transcript: ENSMUST00000148549
SMART Domains Protein: ENSMUSP00000118370
Gene: ENSMUSG00000005378

DomainStartEndE-ValueType
Pfam:Methyltransf_23 3 89 1.4e-8 PFAM
Pfam:Methyltransf_11 27 93 5.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149108
Predicted Effect probably benign
Transcript: ENSMUST00000201554
Predicted Effect probably benign
Transcript: ENSMUST00000202478
Meta Mutation Damage Score 0.5916 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a nuclear localization signal and an S-adenosyl-L-methionine binding motif typical of methyltransferases, suggesting that the encoded protein may act on DNA methylation. This gene is deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternatively spliced transcript variants have been found. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 A G 15: 91,178,283 V484A probably damaging Het
Adam22 A T 5: 8,180,227 probably benign Het
Adamts18 G T 8: 113,713,193 P923T probably benign Het
AI314180 A G 4: 58,820,086 probably benign Het
Ank3 C T 10: 70,001,974 T1604I possibly damaging Het
Armc10 A G 5: 21,653,434 Q159R probably damaging Het
Arnt2 T A 7: 84,275,345 T425S probably benign Het
B4galt3 A G 1: 171,271,773 T36A possibly damaging Het
Bbx A G 16: 50,200,414 V799A probably damaging Het
Cnga2 T A X: 72,006,127 F133I possibly damaging Het
Crispld1 A G 1: 17,752,878 T390A probably benign Het
Cyp4f39 T A 17: 32,483,454 D308E probably damaging Het
Dnah6 A G 6: 73,038,746 V3584A probably damaging Het
Frk T C 10: 34,608,381 I450T probably benign Het
Grm6 T C 11: 50,859,989 S660P probably damaging Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Hyi G A 4: 118,362,477 G237D probably damaging Het
Jrkl T C 9: 13,245,371 N95S probably benign Het
Kif1bp A G 10: 62,563,027 probably benign Het
Nanog T C 6: 122,712,717 probably null Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Olfr676 T C 7: 105,035,303 F35S probably benign Het
Olfr813 T C 10: 129,856,698 F60S probably damaging Het
Pcdha3 T C 18: 36,947,351 V382A probably damaging Het
Pla2g4c T A 7: 13,337,751 N165K probably benign Het
Rexo5 T C 7: 119,825,577 I362T probably benign Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Rpusd2 T C 2: 119,035,224 V134A probably damaging Het
Serpina1c T A 12: 103,897,000 probably null Het
Slc6a19 A T 13: 73,681,717 I606N probably damaging Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Tas2r143 A G 6: 42,400,694 M153V probably benign Het
Thrb G T 14: 17,925,640 M1I probably null Het
Trbc2 A G 6: 41,546,880 probably benign Het
Trim37 T A 11: 87,196,825 S587R probably benign Het
Ulbp1 T A 10: 7,447,397 H151L probably benign Het
Vmn2r54 A T 7: 12,632,272 L245* probably null Het
Vmn2r78 A C 7: 86,920,751 probably null Het
Xlr5b T C X: 73,157,898 probably null Het
Xrcc4 A C 13: 89,992,588 S167R possibly damaging Het
Zfp994 C T 17: 22,201,560 C136Y probably damaging Het
Other mutations in Bud23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Bud23 APN 5 135061081 missense probably damaging 0.99
IGL03281:Bud23 APN 5 135063887 missense probably benign 0.01
R1103:Bud23 UTSW 5 135061139 missense probably damaging 1.00
R1765:Bud23 UTSW 5 135056043 missense probably benign 0.00
R3710:Bud23 UTSW 5 135056350 missense possibly damaging 0.54
R5109:Bud23 UTSW 5 135061023 intron probably benign
R5550:Bud23 UTSW 5 135063890 missense probably benign
R5614:Bud23 UTSW 5 135059112 missense probably benign 0.00
R5822:Bud23 UTSW 5 135063921 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTACCGGTGGCAGAACTG -3'
(R):5'- AATGGAGGCCTCGAATCCTG -3'

Sequencing Primer
(F):5'- TGCATGTACGCAGACCCAC -3'
(R):5'- GGCGCAGATTGATGACGTC -3'
Posted On2015-07-21