Incidental Mutation 'R4486:Trim37'
ID 331627
Institutional Source Beutler Lab
Gene Symbol Trim37
Ensembl Gene ENSMUSG00000018548
Gene Name tripartite motif-containing 37
Synonyms MUL, TEF3, 1110032A10Rik, 2810004E07Rik
MMRRC Submission 041742-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4486 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 87017903-87111509 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 87087651 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 587 (S587R)
Ref Sequence ENSEMBL: ENSMUSP00000049057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041282]
AlphaFold Q6PCX9
Predicted Effect probably benign
Transcript: ENSMUST00000041282
AA Change: S587R

PolyPhen 2 Score 0.308 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000049057
Gene: ENSMUSG00000018548
AA Change: S587R

DomainStartEndE-ValueType
RING 15 54 1.71e-1 SMART
BBOX 90 132 7.32e-12 SMART
BBC 132 254 3.05e-31 SMART
MATH 281 384 1.51e-13 SMART
low complexity region 494 504 N/A INTRINSIC
low complexity region 516 529 N/A INTRINSIC
low complexity region 535 545 N/A INTRINSIC
low complexity region 579 588 N/A INTRINSIC
low complexity region 612 626 N/A INTRINSIC
low complexity region 795 808 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152637
Predicted Effect unknown
Transcript: ENSMUST00000154138
AA Change: S30R
SMART Domains Protein: ENSMUSP00000118260
Gene: ENSMUSG00000018548
AA Change: S30R

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 56 70 N/A INTRINSIC
low complexity region 198 211 N/A INTRINSIC
Meta Mutation Damage Score 0.0718 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: The protein encoded by this gene is part of the tripartite-motif containing family (TRIM), which is typified by the RING, B-box type 1, B-box type 2, and coiled-coil region domains. In mouse this protein is proposed to oligomerize through its coiled coil domain and has been reported to be expressed in neural crest-derived tissues as well as in tissues whose development is regulated by mesenchymal-epithelial interactions. In humans, mutations in this gene are associated with mulibrey (muscle-liver-brain-eye) nanism, an autosomal recessive disorder characterized by prenatal onset growth failure, cardiomyopathy and dysmorphic features. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are infertile due to gonadal degeneration and exhibit late-onset weight loss, smaller skull size, non-compaction cardiomyopathy, hepatomegaly, fatty liver, altered glucose metabolism, splenomegaly, and increased tumor incidence. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Gene trapped(7)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 A G 15: 91,062,486 (GRCm39) V484A probably damaging Het
Adam22 A T 5: 8,230,227 (GRCm39) probably benign Het
Adamts18 G T 8: 114,439,825 (GRCm39) P923T probably benign Het
Ank3 C T 10: 69,837,804 (GRCm39) T1604I possibly damaging Het
Armc10 A G 5: 21,858,432 (GRCm39) Q159R probably damaging Het
Arnt2 T A 7: 83,924,553 (GRCm39) T425S probably benign Het
B4galt3 A G 1: 171,099,343 (GRCm39) T36A possibly damaging Het
Bbx A G 16: 50,020,777 (GRCm39) V799A probably damaging Het
Bud23 T C 5: 135,092,779 (GRCm39) probably null Het
Cnga2 T A X: 71,049,733 (GRCm39) F133I possibly damaging Het
Crispld1 A G 1: 17,823,102 (GRCm39) T390A probably benign Het
Cyp4f39 T A 17: 32,702,428 (GRCm39) D308E probably damaging Het
Dnah6 A G 6: 73,015,729 (GRCm39) V3584A probably damaging Het
Ecpas A G 4: 58,820,086 (GRCm39) probably benign Het
Frk T C 10: 34,484,377 (GRCm39) I450T probably benign Het
Grm6 T C 11: 50,750,816 (GRCm39) S660P probably damaging Het
Hao2 T A 3: 98,789,341 (GRCm39) I116F probably damaging Het
Hyi G A 4: 118,219,674 (GRCm39) G237D probably damaging Het
Jrkl T C 9: 13,245,376 (GRCm39) N95S probably benign Het
Kifbp A G 10: 62,398,806 (GRCm39) probably benign Het
Nanog T C 6: 122,689,676 (GRCm39) probably null Het
Ngf G A 3: 102,428,015 (GRCm39) D255N probably damaging Het
Nlrp4e A G 7: 23,020,652 (GRCm39) I380V probably benign Het
Or52e7 T C 7: 104,684,510 (GRCm39) F35S probably benign Het
Or6c76b T C 10: 129,692,567 (GRCm39) F60S probably damaging Het
Pcdha3 T C 18: 37,080,404 (GRCm39) V382A probably damaging Het
Pla2g4c T A 7: 13,071,676 (GRCm39) N165K probably benign Het
Rexo5 T C 7: 119,424,800 (GRCm39) I362T probably benign Het
Rpl7a-ps3 G A 15: 36,308,429 (GRCm39) noncoding transcript Het
Rpusd2 T C 2: 118,865,705 (GRCm39) V134A probably damaging Het
Serpina1c T A 12: 103,863,259 (GRCm39) probably null Het
Slc6a19 A T 13: 73,829,836 (GRCm39) I606N probably damaging Het
Smchd1 T C 17: 71,714,230 (GRCm39) T878A probably benign Het
Tas2r143 A G 6: 42,377,628 (GRCm39) M153V probably benign Het
Thrb G T 14: 17,925,640 (GRCm38) M1I probably null Het
Trbc2 A G 6: 41,523,814 (GRCm39) probably benign Het
Ulbp1 T A 10: 7,397,397 (GRCm39) H151L probably benign Het
Vmn2r54 A T 7: 12,366,199 (GRCm39) L245* probably null Het
Vmn2r78 A C 7: 86,569,959 (GRCm39) probably null Het
Xlr5b T C X: 72,201,504 (GRCm39) probably null Het
Xrcc4 A C 13: 90,140,707 (GRCm39) S167R possibly damaging Het
Zfp994 C T 17: 22,420,541 (GRCm39) C136Y probably damaging Het
Other mutations in Trim37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Trim37 APN 11 87,077,219 (GRCm39) missense probably damaging 1.00
IGL01372:Trim37 APN 11 87,075,772 (GRCm39) missense probably benign 0.00
IGL01510:Trim37 APN 11 87,068,686 (GRCm39) missense probably damaging 1.00
IGL02055:Trim37 APN 11 87,057,475 (GRCm39) missense probably benign 0.44
IGL02106:Trim37 APN 11 87,092,230 (GRCm39) nonsense probably null
IGL02251:Trim37 APN 11 87,058,256 (GRCm39) splice site probably benign
IGL02498:Trim37 APN 11 87,075,876 (GRCm39) missense probably benign
IGL02836:Trim37 APN 11 87,087,785 (GRCm39) missense probably benign 0.01
IGL03089:Trim37 APN 11 87,080,963 (GRCm39) missense probably damaging 1.00
IGL03302:Trim37 APN 11 87,037,827 (GRCm39) missense possibly damaging 0.89
IGL03347:Trim37 APN 11 87,092,447 (GRCm39) missense possibly damaging 0.80
G5030:Trim37 UTSW 11 87,033,967 (GRCm39) missense probably damaging 0.96
R0396:Trim37 UTSW 11 87,037,794 (GRCm39) missense probably damaging 1.00
R0544:Trim37 UTSW 11 87,036,328 (GRCm39) nonsense probably null
R0946:Trim37 UTSW 11 87,037,781 (GRCm39) missense probably damaging 0.99
R1481:Trim37 UTSW 11 87,020,585 (GRCm39) nonsense probably null
R1799:Trim37 UTSW 11 87,068,845 (GRCm39) missense probably damaging 1.00
R1851:Trim37 UTSW 11 87,109,132 (GRCm39) missense probably damaging 1.00
R2107:Trim37 UTSW 11 87,050,651 (GRCm39) missense probably benign 0.04
R3878:Trim37 UTSW 11 87,096,828 (GRCm39) missense probably benign 0.10
R4049:Trim37 UTSW 11 87,031,429 (GRCm39) critical splice donor site probably null
R4224:Trim37 UTSW 11 87,107,289 (GRCm39) missense probably damaging 1.00
R5244:Trim37 UTSW 11 87,109,083 (GRCm39) missense probably benign 0.10
R5343:Trim37 UTSW 11 87,028,429 (GRCm39) missense probably damaging 0.98
R5417:Trim37 UTSW 11 87,057,505 (GRCm39) missense probably damaging 1.00
R5894:Trim37 UTSW 11 87,092,266 (GRCm39) missense probably damaging 0.99
R5911:Trim37 UTSW 11 87,087,663 (GRCm39) nonsense probably null
R5957:Trim37 UTSW 11 87,036,377 (GRCm39) missense probably damaging 1.00
R6159:Trim37 UTSW 11 87,107,374 (GRCm39) critical splice donor site probably null
R6479:Trim37 UTSW 11 87,107,313 (GRCm39) nonsense probably null
R6527:Trim37 UTSW 11 87,080,910 (GRCm39) missense probably damaging 1.00
R7021:Trim37 UTSW 11 87,058,335 (GRCm39) missense probably benign 0.01
R7734:Trim37 UTSW 11 87,068,821 (GRCm39) missense probably damaging 1.00
R7849:Trim37 UTSW 11 87,092,270 (GRCm39) missense possibly damaging 0.87
R7938:Trim37 UTSW 11 87,037,863 (GRCm39) missense probably benign 0.05
R7968:Trim37 UTSW 11 87,040,179 (GRCm39) missense possibly damaging 0.47
R8046:Trim37 UTSW 11 87,037,794 (GRCm39) missense possibly damaging 0.89
R8112:Trim37 UTSW 11 87,109,093 (GRCm39) missense possibly damaging 0.80
R8735:Trim37 UTSW 11 87,037,885 (GRCm39) critical splice donor site probably null
R8770:Trim37 UTSW 11 87,050,675 (GRCm39) missense probably damaging 1.00
R8911:Trim37 UTSW 11 87,097,629 (GRCm39) missense possibly damaging 0.89
R9234:Trim37 UTSW 11 87,036,393 (GRCm39) missense possibly damaging 0.95
R9332:Trim37 UTSW 11 87,058,328 (GRCm39) missense possibly damaging 0.94
R9346:Trim37 UTSW 11 87,057,426 (GRCm39) critical splice acceptor site probably null
R9431:Trim37 UTSW 11 87,077,257 (GRCm39) missense probably benign 0.34
Z1177:Trim37 UTSW 11 87,075,869 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCCCAGGTTGTGTATACATATAC -3'
(R):5'- TGTGGGCTGCAACAGTGAAG -3'

Sequencing Primer
(F):5'- ATACATATACATCGTTTGTGTGGTG -3'
(R):5'- CTGCAACAGTGAAGCAGACG -3'
Posted On 2015-07-21