Incidental Mutation 'R4487:Mthfr'
ID331655
Institutional Source Beutler Lab
Gene Symbol Mthfr
Ensembl Gene ENSMUSG00000029009
Gene Namemethylenetetrahydrofolate reductase
Synonyms
MMRRC Submission 041743-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.772) question?
Stock #R4487 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location148039077-148059551 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 148051427 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 278 (K278R)
Ref Sequence ENSEMBL: ENSMUSP00000095395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069604] [ENSMUST00000097788] [ENSMUST00000152498]
Predicted Effect probably benign
Transcript: ENSMUST00000069604
AA Change: K319R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000069774
Gene: ENSMUSG00000029009
AA Change: K319R

DomainStartEndE-ValueType
low complexity region 48 73 N/A INTRINSIC
Pfam:MTHFR 88 377 2.3e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097788
AA Change: K278R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000095395
Gene: ENSMUSG00000029009
AA Change: K278R

DomainStartEndE-ValueType
low complexity region 7 32 N/A INTRINSIC
Pfam:MTHFR 47 336 5.9e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152498
AA Change: K294R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117095
Gene: ENSMUSG00000029009
AA Change: K294R

DomainStartEndE-ValueType
low complexity region 23 48 N/A INTRINSIC
Pfam:MTHFR 63 352 2.4e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156113
Meta Mutation Damage Score 0.1228 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the conversion of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, a co-substrate for homocysteine remethylation to methionine. Genetic variation in this gene influences susceptibility to occlusive vascular disease, neural tube defects, colon cancer and acute leukemia, and mutations in this gene are associated with methylenetetrahydrofolate reductase deficiency.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene have elevated plasma levels of homocysteine. They also display delayed growth and development and a reduced survival rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik A G 9: 50,740,631 L99P probably damaging Het
Abcd2 A G 15: 91,178,283 V484A probably damaging Het
Adgrv1 A G 13: 81,440,066 I4467T probably damaging Het
Ash1l T A 3: 88,985,315 D1500E possibly damaging Het
BC017158 T C 7: 128,288,358 D24G probably damaging Het
C1ql2 A T 1: 120,341,680 Y188F possibly damaging Het
Cnga2 T A X: 72,006,127 F133I possibly damaging Het
Crybg2 T C 4: 134,074,201 S891P probably benign Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Htr1b A T 9: 81,631,539 D338E probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif9 A G 9: 110,494,484 E225G probably null Het
Krt76 T C 15: 101,890,482 K256R possibly damaging Het
Mapk4 T C 18: 73,930,975 D392G probably damaging Het
Mup4 T A 4: 59,960,547 E18V probably damaging Het
Nepro A G 16: 44,735,726 K416E probably damaging Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nmu A G 5: 76,344,062 probably null Het
Nt5m A G 11: 59,848,347 Y73C probably damaging Het
Oaz3 A T 3: 94,435,130 probably null Het
Pgap1 A G 1: 54,528,592 S365P probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pus7l A G 15: 94,531,617 I440T possibly damaging Het
Raph1 C T 1: 60,502,869 S362N possibly damaging Het
Rftn2 A G 1: 55,202,152 Y330H possibly damaging Het
Rhot2 G A 17: 25,839,493 H580Y probably benign Het
Rnase2a A T 14: 51,255,845 M21K unknown Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Snx1 A T 9: 66,089,595 V459E possibly damaging Het
Suz12 A G 11: 80,032,113 T694A probably benign Het
Tg G A 15: 66,671,396 C53Y probably damaging Het
Tor1aip1 G T 1: 156,007,124 T326K probably damaging Het
Vmn1r61 C A 7: 5,610,925 C130F possibly damaging Het
Xlr5b T C X: 73,157,898 probably null Het
Other mutations in Mthfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Mthfr APN 4 148041270 missense probably benign
IGL00911:Mthfr APN 4 148041302 missense probably benign 0.01
R0116:Mthfr UTSW 4 148051523 missense probably benign 0.00
R0207:Mthfr UTSW 4 148052224 missense probably damaging 1.00
R0268:Mthfr UTSW 4 148055428 missense probably damaging 1.00
R0344:Mthfr UTSW 4 148055428 missense probably damaging 1.00
R0762:Mthfr UTSW 4 148055443 missense possibly damaging 0.65
R1433:Mthfr UTSW 4 148055443 missense possibly damaging 0.92
R1464:Mthfr UTSW 4 148053572 splice site probably benign
R1972:Mthfr UTSW 4 148051927 missense probably damaging 1.00
R3154:Mthfr UTSW 4 148051604 missense probably benign 0.12
R3407:Mthfr UTSW 4 148055061 missense probably damaging 1.00
R3773:Mthfr UTSW 4 148044450 missense probably benign 0.00
R4153:Mthfr UTSW 4 148051475 missense probably damaging 0.99
R4291:Mthfr UTSW 4 148055492 missense probably damaging 1.00
R4574:Mthfr UTSW 4 148043541 missense possibly damaging 0.95
R4583:Mthfr UTSW 4 148051872 missense possibly damaging 0.80
R4847:Mthfr UTSW 4 148048139 missense probably damaging 0.99
R5183:Mthfr UTSW 4 148051360 splice site probably null
R5536:Mthfr UTSW 4 148044483 missense probably damaging 1.00
R5664:Mthfr UTSW 4 148055466 missense probably damaging 1.00
R6161:Mthfr UTSW 4 148041754 missense probably benign 0.35
R7285:Mthfr UTSW 4 148053599 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTCCCAGACTCTACAAATGAGAGAG -3'
(R):5'- CCACATGCCCAGTTGCTTTAG -3'

Sequencing Primer
(F):5'- GTACTGCCTTGCAATACCACCTG -3'
(R):5'- GGTATAGAAGTGGAGGCCT -3'
Posted On2015-07-21