Incidental Mutation 'R4498:Mmp24'
ID331682
Institutional Source Beutler Lab
Gene Symbol Mmp24
Ensembl Gene ENSMUSG00000027612
Gene Namematrix metallopeptidase 24
SynonymsMembrane type 5-MMP, MT5-MMP
MMRRC Submission 041751-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R4498 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location155775342-155818366 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155813988 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 449 (I449V)
Ref Sequence ENSEMBL: ENSMUSP00000029141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029141] [ENSMUST00000124586]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029141
AA Change: I449V

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029141
Gene: ENSMUSG00000027612
AA Change: I449V

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:PG_binding_1 52 107 6.9e-14 PFAM
ZnMc 132 301 1.78e-60 SMART
low complexity region 323 346 N/A INTRINSIC
HX 357 400 7.4e-9 SMART
HX 402 446 7.01e-10 SMART
HX 449 495 6.49e-14 SMART
HX 497 542 6.64e-11 SMART
Pfam:DUF3377 548 618 1.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124586
SMART Domains Protein: ENSMUSP00000145349
Gene: ENSMUSG00000074649

DomainStartEndE-ValueType
low complexity region 7 37 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135945
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 91% (53/58)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein do not develop neuropathic pain with mechanical allodynia after sciatic nerve injury, display enhanced sensitivity to noxious thermal stimuli under basal conditions, and develop hyperalgesia during inflammation. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene fail to develop neuropathic pain after peripheral nerve injury. They also experience reduced stress and enhanced mechanical coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 G A 15: 81,895,285 A97T probably damaging Het
Acot9 T A X: 155,264,068 L18* probably null Het
Arhgap12 A T 18: 6,111,774 C69S probably damaging Het
C87499 A T 4: 88,628,892 probably null Het
Ccdc17 G T 4: 116,597,241 probably benign Het
Ctnnd2 A C 15: 30,619,874 D124A probably damaging Het
Cux1 T C 5: 136,312,993 N424S probably damaging Het
Dhrs7c T C 11: 67,815,880 F214S possibly damaging Het
Fat2 T C 11: 55,270,097 D3269G possibly damaging Het
Fhod3 T A 18: 25,110,239 probably null Het
Glul G T 1: 153,907,103 G187* probably null Het
Gnmt ATTAGGGGATGGTCTTAGGG ATTAGGG 17: 46,725,736 probably benign Het
H2-Q7 A T 17: 35,439,530 Y48F probably damaging Het
Hes3 T C 4: 152,287,085 T136A probably benign Het
Krt40 T C 11: 99,543,074 T29A possibly damaging Het
Lrrc37a C A 11: 103,501,798 D934Y probably benign Het
Mctp2 T A 7: 72,183,851 D581V probably damaging Het
Med27 T C 2: 29,471,342 S38P probably damaging Het
Mff A G 1: 82,741,780 probably benign Het
Mmadhc T C 2: 50,280,224 K292R probably benign Het
Mthfd1 G T 12: 76,314,990 L123F probably damaging Het
Mug2 T A 6: 122,082,752 L1363Q probably damaging Het
Myh4 T C 11: 67,251,752 I913T probably damaging Het
Myo16 T A 8: 10,435,869 N649K probably benign Het
Myo7b A G 18: 32,014,229 I87T probably benign Het
Ndst4 A G 3: 125,438,358 D192G probably benign Het
Nup155 A G 15: 8,153,673 D1239G possibly damaging Het
Olfr1444 T C 19: 12,862,669 V298A probably damaging Het
Olfr866 G C 9: 20,027,733 N68K possibly damaging Het
Phf10 T A 17: 14,945,115 N493I probably benign Het
Prr12 T C 7: 45,045,914 E1376G unknown Het
Rasa3 T C 8: 13,614,587 H75R probably benign Het
Rin3 G A 12: 102,369,680 V537M probably damaging Het
Samd4 C T 14: 47,096,109 T272I probably damaging Het
Sept5 C T 16: 18,623,392 G257D probably damaging Het
Serpina6 T C 12: 103,654,067 K141R probably benign Het
Siglecf T A 7: 43,352,276 I170N possibly damaging Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Stk40 G A 4: 126,129,751 probably null Het
Syne1 A G 10: 5,031,768 S8700P probably benign Het
Tbc1d4 C T 14: 101,608,336 G42E probably damaging Het
Tfap2c C T 2: 172,557,182 Q425* probably null Het
Tmem255b T C 8: 13,455,998 S202P probably damaging Het
Traf6 T C 2: 101,684,546 S16P probably benign Het
Ttc12 A G 9: 49,472,405 I66T probably damaging Het
Ttc21a G A 9: 119,958,819 D818N possibly damaging Het
Zfp81 A T 17: 33,334,703 I379N possibly damaging Het
Zgrf1 C A 3: 127,586,100 S211* probably null Het
Other mutations in Mmp24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Mmp24 APN 2 155799887 missense probably damaging 1.00
IGL02089:Mmp24 APN 2 155812293 missense probably damaging 1.00
IGL02452:Mmp24 APN 2 155815788 missense probably damaging 1.00
R0600:Mmp24 UTSW 2 155792597 missense probably benign 0.01
R1381:Mmp24 UTSW 2 155814127 missense possibly damaging 0.46
R4497:Mmp24 UTSW 2 155813988 missense possibly damaging 0.85
R4727:Mmp24 UTSW 2 155815899 missense possibly damaging 0.55
R4985:Mmp24 UTSW 2 155814096 missense probably damaging 0.99
R5020:Mmp24 UTSW 2 155810284 missense probably benign 0.09
R5501:Mmp24 UTSW 2 155798136 missense probably damaging 1.00
R5686:Mmp24 UTSW 2 155799777 missense probably damaging 0.99
R5709:Mmp24 UTSW 2 155792542 missense probably damaging 1.00
R5773:Mmp24 UTSW 2 155799909 missense probably damaging 1.00
R6452:Mmp24 UTSW 2 155815753 missense possibly damaging 0.67
R6657:Mmp24 UTSW 2 155798179 missense probably damaging 1.00
R7015:Mmp24 UTSW 2 155792624 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGATTGGCTTTTGCTCCACAG -3'
(R):5'- TTGCTGATGAAGGCCCCTTG -3'

Sequencing Primer
(F):5'- GGGGCTAAAACTCACATTCCGG -3'
(R):5'- ATGAAGGCCCCTTGCGGAG -3'
Posted On2015-07-21