Incidental Mutation 'R4498:Zgrf1'
ID331685
Institutional Source Beutler Lab
Gene Symbol Zgrf1
Ensembl Gene ENSMUSG00000051278
Gene Namezinc finger, GRF-type containing 1
Synonyms4930422G04Rik
MMRRC Submission 041751-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R4498 (G1)
Quality Score175
Status Validated
Chromosome3
Chromosomal Location127553489-127618023 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 127586100 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 211 (S211*)
Ref Sequence ENSEMBL: ENSMUSP00000143570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043108] [ENSMUST00000196141] [ENSMUST00000196341] [ENSMUST00000199888] [ENSMUST00000200490]
Predicted Effect probably null
Transcript: ENSMUST00000043108
AA Change: S1095*
SMART Domains Protein: ENSMUSP00000044432
Gene: ENSMUSG00000051278
AA Change: S1095*

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.7e-23 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
low complexity region 896 906 N/A INTRINSIC
Pfam:zf-GRF 1109 1153 1.5e-17 PFAM
low complexity region 1316 1328 N/A INTRINSIC
Pfam:AAA_11 1501 1608 1.6e-21 PFAM
Pfam:AAA_12 1616 1802 1.3e-51 PFAM
coiled coil region 1833 1861 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000196141
AA Change: S1095*
SMART Domains Protein: ENSMUSP00000143761
Gene: ENSMUSG00000051278
AA Change: S1095*

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.7e-23 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
low complexity region 896 906 N/A INTRINSIC
Pfam:zf-GRF 1109 1153 1.5e-17 PFAM
low complexity region 1316 1328 N/A INTRINSIC
Pfam:AAA_11 1501 1608 1.6e-21 PFAM
Pfam:AAA_12 1616 1802 1.3e-51 PFAM
coiled coil region 1833 1861 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000196341
AA Change: S211*
SMART Domains Protein: ENSMUSP00000143570
Gene: ENSMUSG00000051278
AA Change: S211*

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
Pfam:zf-GRF 225 269 6.7e-15 PFAM
low complexity region 432 444 N/A INTRINSIC
Pfam:AAA_11 491 659 7.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199888
SMART Domains Protein: ENSMUSP00000142693
Gene: ENSMUSG00000051278

DomainStartEndE-ValueType
Pfam:DUF2439 3 82 3.5e-22 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200490
SMART Domains Protein: ENSMUSP00000143585
Gene: ENSMUSG00000051278

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.4e-20 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
Meta Mutation Damage Score 0.566 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 91% (53/58)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 G A 15: 81,895,285 A97T probably damaging Het
Acot9 T A X: 155,264,068 L18* probably null Het
Arhgap12 A T 18: 6,111,774 C69S probably damaging Het
C87499 A T 4: 88,628,892 probably null Het
Ccdc17 G T 4: 116,597,241 probably benign Het
Ctnnd2 A C 15: 30,619,874 D124A probably damaging Het
Cux1 T C 5: 136,312,993 N424S probably damaging Het
Dhrs7c T C 11: 67,815,880 F214S possibly damaging Het
Fat2 T C 11: 55,270,097 D3269G possibly damaging Het
Fhod3 T A 18: 25,110,239 probably null Het
Glul G T 1: 153,907,103 G187* probably null Het
Gnmt ATTAGGGGATGGTCTTAGGG ATTAGGG 17: 46,725,736 probably benign Het
H2-Q7 A T 17: 35,439,530 Y48F probably damaging Het
Hes3 T C 4: 152,287,085 T136A probably benign Het
Krt40 T C 11: 99,543,074 T29A possibly damaging Het
Lrrc37a C A 11: 103,501,798 D934Y probably benign Het
Mctp2 T A 7: 72,183,851 D581V probably damaging Het
Med27 T C 2: 29,471,342 S38P probably damaging Het
Mff A G 1: 82,741,780 probably benign Het
Mmadhc T C 2: 50,280,224 K292R probably benign Het
Mmp24 A G 2: 155,813,988 I449V possibly damaging Het
Mthfd1 G T 12: 76,314,990 L123F probably damaging Het
Mug2 T A 6: 122,082,752 L1363Q probably damaging Het
Myh4 T C 11: 67,251,752 I913T probably damaging Het
Myo16 T A 8: 10,435,869 N649K probably benign Het
Myo7b A G 18: 32,014,229 I87T probably benign Het
Ndst4 A G 3: 125,438,358 D192G probably damaging Het
Nup155 A G 15: 8,153,673 D1239G possibly damaging Het
Olfr1444 T C 19: 12,862,669 V298A probably damaging Het
Olfr866 G C 9: 20,027,733 N68K possibly damaging Het
Phf10 T A 17: 14,945,115 N493I probably benign Het
Prr12 T C 7: 45,045,914 E1376G unknown Het
Rasa3 T C 8: 13,614,587 H75R probably benign Het
Rin3 G A 12: 102,369,680 V537M probably damaging Het
Samd4 C T 14: 47,096,109 T272I probably damaging Het
Sept5 C T 16: 18,623,392 G257D probably damaging Het
Serpina6 T C 12: 103,654,067 K141R probably benign Het
Siglecf T A 7: 43,352,276 I170N possibly damaging Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Stk40 G A 4: 126,129,751 probably null Het
Syne1 A G 10: 5,031,768 S8700P probably benign Het
Tbc1d4 C T 14: 101,608,336 G42E probably damaging Het
Tfap2c C T 2: 172,557,182 Q425* probably null Het
Tmem255b T C 8: 13,455,998 S202P probably damaging Het
Traf6 T C 2: 101,684,546 S16P probably benign Het
Ttc12 A G 9: 49,472,405 I66T probably damaging Het
Ttc21a G A 9: 119,958,819 D818N possibly damaging Het
Zfp81 A T 17: 33,334,703 I379N possibly damaging Het
Other mutations in Zgrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Zgrf1 APN 3 127588141 splice site probably benign
IGL01153:Zgrf1 APN 3 127602406 missense probably damaging 1.00
IGL01330:Zgrf1 APN 3 127584007 missense probably damaging 1.00
IGL01501:Zgrf1 APN 3 127602562 splice site probably null
IGL01827:Zgrf1 APN 3 127616281 missense probably benign 0.06
IGL02600:Zgrf1 APN 3 127600974 splice site probably benign
IGL03122:Zgrf1 APN 3 127588133 missense possibly damaging 0.91
IGL03365:Zgrf1 APN 3 127598774 missense possibly damaging 0.48
R0015:Zgrf1 UTSW 3 127555397 splice site probably benign
R0243:Zgrf1 UTSW 3 127615446 missense probably damaging 0.99
R0468:Zgrf1 UTSW 3 127562041 missense possibly damaging 0.72
R0497:Zgrf1 UTSW 3 127584650 splice site probably benign
R0505:Zgrf1 UTSW 3 127573238 missense probably benign 0.30
R0511:Zgrf1 UTSW 3 127584660 missense possibly damaging 0.93
R0539:Zgrf1 UTSW 3 127615192 missense probably damaging 1.00
R0617:Zgrf1 UTSW 3 127588038 missense probably benign 0.39
R1298:Zgrf1 UTSW 3 127583889 missense possibly damaging 0.95
R1353:Zgrf1 UTSW 3 127611803 missense probably damaging 1.00
R1593:Zgrf1 UTSW 3 127561026 missense possibly damaging 0.86
R1846:Zgrf1 UTSW 3 127615463 missense probably damaging 1.00
R1912:Zgrf1 UTSW 3 127563137 missense probably benign
R2062:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2064:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2065:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2066:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2067:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2256:Zgrf1 UTSW 3 127561997 missense probably benign 0.18
R2321:Zgrf1 UTSW 3 127562407 nonsense probably null
R2381:Zgrf1 UTSW 3 127556214 missense probably benign 0.02
R2913:Zgrf1 UTSW 3 127598707 missense possibly damaging 0.65
R3147:Zgrf1 UTSW 3 127584148 missense possibly damaging 0.84
R3236:Zgrf1 UTSW 3 127613375 missense probably damaging 1.00
R3237:Zgrf1 UTSW 3 127613375 missense probably damaging 1.00
R4433:Zgrf1 UTSW 3 127562078 missense probably benign
R4441:Zgrf1 UTSW 3 127586137 missense possibly damaging 0.45
R4457:Zgrf1 UTSW 3 127595929 missense probably damaging 1.00
R4598:Zgrf1 UTSW 3 127601030 missense probably benign 0.14
R4701:Zgrf1 UTSW 3 127598704 missense probably benign 0.03
R4898:Zgrf1 UTSW 3 127602436 missense probably damaging 1.00
R4944:Zgrf1 UTSW 3 127561868 nonsense probably null
R5256:Zgrf1 UTSW 3 127602445 missense probably damaging 1.00
R5294:Zgrf1 UTSW 3 127600980 missense probably benign 0.14
R5358:Zgrf1 UTSW 3 127567703 critical splice donor site probably null
R5359:Zgrf1 UTSW 3 127601165 missense possibly damaging 0.95
R5447:Zgrf1 UTSW 3 127563119 missense possibly damaging 0.73
R5569:Zgrf1 UTSW 3 127561025 missense probably benign 0.33
R5887:Zgrf1 UTSW 3 127584765 missense probably damaging 1.00
R5914:Zgrf1 UTSW 3 127561023 missense probably damaging 0.99
R5925:Zgrf1 UTSW 3 127573204 missense possibly damaging 0.84
R5936:Zgrf1 UTSW 3 127562253 missense possibly damaging 0.72
R6087:Zgrf1 UTSW 3 127615486 missense probably damaging 1.00
R6089:Zgrf1 UTSW 3 127595993 missense probably damaging 1.00
R6181:Zgrf1 UTSW 3 127587941 missense probably damaging 1.00
R6277:Zgrf1 UTSW 3 127598812 missense possibly damaging 0.81
R6441:Zgrf1 UTSW 3 127588034 missense possibly damaging 0.93
R6659:Zgrf1 UTSW 3 127616506 missense probably damaging 0.99
R6857:Zgrf1 UTSW 3 127581447 missense probably damaging 0.99
R6932:Zgrf1 UTSW 3 127559632 critical splice donor site probably null
R7008:Zgrf1 UTSW 3 127561772 missense probably benign 0.18
R7175:Zgrf1 UTSW 3 127563590 missense probably damaging 1.00
R7264:Zgrf1 UTSW 3 127563569 missense probably benign 0.00
R7272:Zgrf1 UTSW 3 127598760 missense probably damaging 0.99
R7298:Zgrf1 UTSW 3 127583650 nonsense probably null
R7412:Zgrf1 UTSW 3 127563071 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGACTGCTAAAAGGCTGTTTTC -3'
(R):5'- TGCAGTGAGTTCCTAAGAAGTTTG -3'

Sequencing Primer
(F):5'- GCTAAAAGGCTGTTTTCAAATTGAC -3'
(R):5'- TGTATTCTGGAACACACACAGATC -3'
Posted On2015-07-21