Incidental Mutation 'R4499:Psg25'
ID331751
Institutional Source Beutler Lab
Gene Symbol Psg25
Ensembl Gene ENSMUSG00000070798
Gene Namepregnancy-specific glycoprotein 25
Synonymscea13
MMRRC Submission 041752-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.020) question?
Stock #R4499 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location18519702-18532269 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 18524891 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 287 (E287K)
Ref Sequence ENSEMBL: ENSMUSP00000092389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094795]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094795
AA Change: E287K

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092389
Gene: ENSMUSG00000070798
AA Change: E287K

DomainStartEndE-ValueType
IG 40 141 2.15e-3 SMART
IG 160 261 1.55e0 SMART
IG 280 381 3.59e-5 SMART
IGc2 397 461 1.02e-9 SMART
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 92% (47/51)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,316,527 W948R possibly damaging Het
Ache A C 5: 137,291,932 M508L probably damaging Het
Adgrb2 A T 4: 129,992,661 E198V probably damaging Het
Adgrl4 A G 3: 151,510,785 N535S possibly damaging Het
Agbl3 T C 6: 34,857,598 S906P probably benign Het
Akna T C 4: 63,395,041 T282A probably benign Het
Arfgef2 G A 2: 166,885,814 V1561M probably damaging Het
Arfgef3 T C 10: 18,608,343 D1388G possibly damaging Het
Asnsd1 A G 1: 53,347,970 V166A probably benign Het
Bank1 T C 3: 136,284,243 I29V probably benign Het
Bpifb5 A T 2: 154,240,758 I484F possibly damaging Het
Camta2 T C 11: 70,674,686 E788G probably damaging Het
Ccdc18 T G 5: 108,228,960 S1422R possibly damaging Het
Cdc42bpg C T 19: 6,320,555 P1226L possibly damaging Het
Cep126 T C 9: 8,101,588 N315S possibly damaging Het
Dcaf4 T A 12: 83,539,360 L367Q probably damaging Het
Dcc A T 18: 71,547,317 V616D probably benign Het
Dennd4a G A 9: 64,910,123 D1680N possibly damaging Het
Dgkq C G 5: 108,649,661 E788D possibly damaging Het
Dpep2 T C 8: 105,985,482 E282G probably benign Het
Gm14124 T G 2: 150,269,442 V684G possibly damaging Het
Gm8221 T A 15: 77,626,045 noncoding transcript Het
Ice1 T C 13: 70,609,027 S280G possibly damaging Het
Lrrc2 A T 9: 110,962,645 Q155L probably benign Het
Mesd G A 7: 83,897,977 R216Q probably benign Het
Msh6 T A 17: 87,980,269 N112K probably damaging Het
Myo15b A G 11: 115,890,952 E307G probably benign Het
Nod1 T A 6: 54,943,996 N446Y probably damaging Het
Nrap G A 19: 56,351,481 T787I probably damaging Het
P2ry12 A G 3: 59,217,657 I199T probably damaging Het
Prr11 T G 11: 87,098,707 K279N possibly damaging Het
Rusc1 T C 3: 89,092,308 S56G probably benign Het
Slc16a7 T C 10: 125,228,187 N427S probably damaging Het
Slc47a1 T A 11: 61,359,529 I341L probably benign Het
Slc9a8 T A 2: 167,424,193 L30Q probably benign Het
Ssh2 T A 11: 77,393,067 L49* probably null Het
Stard9 T A 2: 120,700,241 D2326E probably benign Het
Thbs1 T C 2: 118,119,950 I688T possibly damaging Het
Ttn T A 2: 76,916,478 E4742D probably benign Het
Vps37b T C 5: 124,007,626 I117V probably damaging Het
Xirp2 A T 2: 67,513,438 M2008L probably benign Het
Zfp53 A G 17: 21,509,235 E510G probably damaging Het
Zswim8 T A 14: 20,714,297 S578R probably benign Het
Other mutations in Psg25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Psg25 APN 7 18526181 splice site probably benign
IGL00508:Psg25 APN 7 18529731 missense probably benign
IGL01154:Psg25 APN 7 18524699 missense probably benign 0.01
IGL01388:Psg25 APN 7 18529665 missense possibly damaging 0.87
IGL02222:Psg25 APN 7 18529727 missense probably damaging 1.00
IGL02261:Psg25 APN 7 18521343 missense probably benign 0.09
IGL02309:Psg25 APN 7 18526424 missense probably damaging 0.98
IGL02803:Psg25 APN 7 18526287 missense possibly damaging 0.47
IGL03334:Psg25 APN 7 18529774 missense probably benign 0.01
R0711:Psg25 UTSW 7 18529560 nonsense probably null
R1458:Psg25 UTSW 7 18529587 missense probably damaging 1.00
R1598:Psg25 UTSW 7 18532003 nonsense probably null
R2064:Psg25 UTSW 7 18521253 missense probably damaging 0.96
R2066:Psg25 UTSW 7 18529562 missense probably damaging 1.00
R4485:Psg25 UTSW 7 18526278 missense probably damaging 1.00
R4514:Psg25 UTSW 7 18529608 nonsense probably null
R4547:Psg25 UTSW 7 18524704 missense probably damaging 1.00
R4604:Psg25 UTSW 7 18529803 missense probably benign 0.05
R4886:Psg25 UTSW 7 18524913 missense probably benign 0.00
R5121:Psg25 UTSW 7 18526536 missense possibly damaging 0.68
R5208:Psg25 UTSW 7 18526535 missense probably benign 0.00
R5267:Psg25 UTSW 7 18524786 missense possibly damaging 0.78
R5376:Psg25 UTSW 7 18526535 missense probably benign 0.00
R5425:Psg25 UTSW 7 18524784 nonsense probably null
R5749:Psg25 UTSW 7 18524851 missense probably damaging 1.00
R6050:Psg25 UTSW 7 18526478 missense probably benign 0.37
R6862:Psg25 UTSW 7 18521398 missense probably benign 0.03
R6962:Psg25 UTSW 7 18529754 missense probably damaging 1.00
R7238:Psg25 UTSW 7 18532202 start gained probably benign
Z1088:Psg25 UTSW 7 18529591 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTCTCAGTGACATCCTGGAGC -3'
(R):5'- GACACACCCTTACATGCCTG -3'

Sequencing Primer
(F):5'- AGGGATCCATCGGTGTACCCTATC -3'
(R):5'- CATGCCTGTCTATGCTGAATGAAG -3'
Posted On2015-07-21