Incidental Mutation 'R4499:Cep126'
ID331754
Institutional Source Beutler Lab
Gene Symbol Cep126
Ensembl Gene ENSMUSG00000040729
Gene Namecentrosomal protein 126
SynonymsAK129341
MMRRC Submission 041752-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4499 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location8076461-8134294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8101588 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 315 (N315S)
Ref Sequence ENSEMBL: ENSMUSP00000042904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037397]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037397
AA Change: N315S

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000042904
Gene: ENSMUSG00000040729
AA Change: N315S

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
Pfam:K1377 100 1061 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214150
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 92% (47/51)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,316,527 W948R possibly damaging Het
Ache A C 5: 137,291,932 M508L probably damaging Het
Adgrb2 A T 4: 129,992,661 E198V probably damaging Het
Adgrl4 A G 3: 151,510,785 N535S possibly damaging Het
Agbl3 T C 6: 34,857,598 S906P probably benign Het
Akna T C 4: 63,395,041 T282A probably benign Het
Arfgef2 G A 2: 166,885,814 V1561M probably damaging Het
Arfgef3 T C 10: 18,608,343 D1388G possibly damaging Het
Asnsd1 A G 1: 53,347,970 V166A probably benign Het
Bank1 T C 3: 136,284,243 I29V probably benign Het
Bpifb5 A T 2: 154,240,758 I484F possibly damaging Het
Camta2 T C 11: 70,674,686 E788G probably damaging Het
Ccdc18 T G 5: 108,228,960 S1422R possibly damaging Het
Cdc42bpg C T 19: 6,320,555 P1226L possibly damaging Het
Dcaf4 T A 12: 83,539,360 L367Q probably damaging Het
Dcc A T 18: 71,547,317 V616D probably benign Het
Dennd4a G A 9: 64,910,123 D1680N possibly damaging Het
Dgkq C G 5: 108,649,661 E788D possibly damaging Het
Dpep2 T C 8: 105,985,482 E282G probably benign Het
Gm14124 T G 2: 150,269,442 V684G possibly damaging Het
Gm8221 T A 15: 77,626,045 noncoding transcript Het
Ice1 T C 13: 70,609,027 S280G possibly damaging Het
Lrrc2 A T 9: 110,962,645 Q155L probably benign Het
Mesd G A 7: 83,897,977 R216Q probably benign Het
Msh6 T A 17: 87,980,269 N112K probably damaging Het
Myo15b A G 11: 115,890,952 E307G probably benign Het
Nod1 T A 6: 54,943,996 N446Y probably damaging Het
Nrap G A 19: 56,351,481 T787I probably damaging Het
P2ry12 A G 3: 59,217,657 I199T probably damaging Het
Prr11 T G 11: 87,098,707 K279N possibly damaging Het
Psg25 C T 7: 18,524,891 E287K possibly damaging Het
Rusc1 T C 3: 89,092,308 S56G probably benign Het
Slc16a7 T C 10: 125,228,187 N427S probably damaging Het
Slc47a1 T A 11: 61,359,529 I341L probably benign Het
Slc9a8 T A 2: 167,424,193 L30Q probably benign Het
Ssh2 T A 11: 77,393,067 L49* probably null Het
Stard9 T A 2: 120,700,241 D2326E probably benign Het
Thbs1 T C 2: 118,119,950 I688T possibly damaging Het
Ttn T A 2: 76,916,478 E4742D probably benign Het
Vps37b T C 5: 124,007,626 I117V probably damaging Het
Xirp2 A T 2: 67,513,438 M2008L probably benign Het
Zfp53 A G 17: 21,509,235 E510G probably damaging Het
Zswim8 T A 14: 20,714,297 S578R probably benign Het
Other mutations in Cep126
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01633:Cep126 APN 9 8103319 missense possibly damaging 0.57
IGL01967:Cep126 APN 9 8095208 splice site probably null
IGL02065:Cep126 APN 9 8099924 missense probably benign 0.09
IGL03215:Cep126 APN 9 8100530 nonsense probably null
R0064:Cep126 UTSW 9 8130182 splice site probably benign
R0064:Cep126 UTSW 9 8130182 splice site probably benign
R0184:Cep126 UTSW 9 8103395 missense probably benign 0.19
R0835:Cep126 UTSW 9 8130223 missense probably damaging 1.00
R0980:Cep126 UTSW 9 8100719 missense probably damaging 0.99
R1288:Cep126 UTSW 9 8112181 missense probably benign 0.01
R1341:Cep126 UTSW 9 8099776 missense possibly damaging 0.78
R1351:Cep126 UTSW 9 8100086 missense probably damaging 0.99
R1484:Cep126 UTSW 9 8100553 missense possibly damaging 0.81
R1707:Cep126 UTSW 9 8100382 missense probably benign 0.00
R1732:Cep126 UTSW 9 8099761 missense probably benign
R1903:Cep126 UTSW 9 8120747 missense possibly damaging 0.58
R1968:Cep126 UTSW 9 8100908 missense probably damaging 1.00
R2216:Cep126 UTSW 9 8120678 missense probably damaging 1.00
R2260:Cep126 UTSW 9 8101748 missense possibly damaging 0.50
R2444:Cep126 UTSW 9 8101306 missense probably damaging 1.00
R4208:Cep126 UTSW 9 8100821 missense probably damaging 1.00
R4585:Cep126 UTSW 9 8103337 missense probably damaging 0.99
R5547:Cep126 UTSW 9 8100427 missense probably damaging 0.97
R5752:Cep126 UTSW 9 8120745 nonsense probably null
R5794:Cep126 UTSW 9 8103439 missense possibly damaging 0.64
R5932:Cep126 UTSW 9 8103508 missense probably damaging 1.00
R5956:Cep126 UTSW 9 8112119 missense probably benign 0.08
R6354:Cep126 UTSW 9 8099927 missense probably damaging 1.00
R6442:Cep126 UTSW 9 8100563 missense probably benign 0.14
R6964:Cep126 UTSW 9 8112100 missense probably null 0.99
R7134:Cep126 UTSW 9 8103382 missense probably damaging 1.00
X0060:Cep126 UTSW 9 8087255 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCTCCTTCAGTGGGATC -3'
(R):5'- GAGCGTGAAGAAATATACATCACAC -3'

Sequencing Primer
(F):5'- TATCTAGTGCAACTACGGATGGACTG -3'
(R):5'- ACTTAGTATGAAGCCTTCCACG -3'
Posted On2015-07-21