Incidental Mutation 'R4499:Myo15b'
ID331763
Institutional Source Beutler Lab
Gene Symbol Myo15b
Ensembl Gene ENSMUSG00000034427
Gene Namemyosin XVB
SynonymsLOC217328, E330039G21Rik, LOC380737
MMRRC Submission 041752-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R4499 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115858406-115892603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115890952 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 307 (E307G)
Ref Sequence ENSEMBL: ENSMUSP00000129226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021097] [ENSMUST00000040703] [ENSMUST00000093911] [ENSMUST00000125835] [ENSMUST00000131578] [ENSMUST00000140174] [ENSMUST00000167507] [ENSMUST00000222123]
Predicted Effect probably benign
Transcript: ENSMUST00000021097
SMART Domains Protein: ENSMUSP00000021097
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
HELICc 274 355 8.68e-22 SMART
Pfam:RecQ_Zn_bind 366 436 1.8e-12 PFAM
low complexity region 472 499 N/A INTRINSIC
PDB:4BK0|B 516 621 2e-51 PDB
Pfam:RecQ5 626 818 3.1e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040703
SMART Domains Protein: ENSMUSP00000048072
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
low complexity region 93 111 N/A INTRINSIC
low complexity region 179 213 N/A INTRINSIC
low complexity region 250 289 N/A INTRINSIC
low complexity region 345 370 N/A INTRINSIC
low complexity region 497 511 N/A INTRINSIC
low complexity region 532 552 N/A INTRINSIC
Blast:MYSc 587 775 3e-15 BLAST
SH3 778 835 1.15e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000093911
AA Change: E2829G
SMART Domains Protein: ENSMUSP00000091439
Gene: ENSMUSG00000034427
AA Change: E2829G

DomainStartEndE-ValueType
MYSc 1 640 2.4e-134 SMART
IQ 660 682 1.03e1 SMART
Pfam:MyTH4 837 945 2.1e-23 PFAM
low complexity region 1050 1068 N/A INTRINSIC
low complexity region 1136 1170 N/A INTRINSIC
low complexity region 1207 1246 N/A INTRINSIC
low complexity region 1302 1327 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
low complexity region 1489 1509 N/A INTRINSIC
SH3 1735 1792 1.15e-7 SMART
Pfam:MyTH4 1928 2029 8.3e-25 PFAM
B41 2032 2235 6.99e-4 SMART
low complexity region 2243 2253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125835
SMART Domains Protein: ENSMUSP00000144423
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
SH3 75 132 7e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131578
SMART Domains Protein: ENSMUSP00000136178
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
HELICc 1 82 8.68e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136774
Predicted Effect probably benign
Transcript: ENSMUST00000140174
SMART Domains Protein: ENSMUSP00000136506
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141947
Predicted Effect probably benign
Transcript: ENSMUST00000167507
AA Change: E307G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000129226
Gene: ENSMUSG00000034427
AA Change: E307G

DomainStartEndE-ValueType
Pfam:MyTH4 100 205 3.1e-24 PFAM
B41 207 410 6.99e-4 SMART
low complexity region 418 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222123
AA Change: E1407G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0576 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 92% (47/51)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,316,527 W948R possibly damaging Het
Ache A C 5: 137,291,932 M508L probably damaging Het
Adgrb2 A T 4: 129,992,661 E198V probably damaging Het
Adgrl4 A G 3: 151,510,785 N535S possibly damaging Het
Agbl3 T C 6: 34,857,598 S906P probably benign Het
Akna T C 4: 63,395,041 T282A probably benign Het
Arfgef2 G A 2: 166,885,814 V1561M probably damaging Het
Arfgef3 T C 10: 18,608,343 D1388G possibly damaging Het
Asnsd1 A G 1: 53,347,970 V166A probably benign Het
Bank1 T C 3: 136,284,243 I29V probably benign Het
Bpifb5 A T 2: 154,240,758 I484F possibly damaging Het
Camta2 T C 11: 70,674,686 E788G probably damaging Het
Ccdc18 T G 5: 108,228,960 S1422R possibly damaging Het
Cdc42bpg C T 19: 6,320,555 P1226L possibly damaging Het
Cep126 T C 9: 8,101,588 N315S possibly damaging Het
Dcaf4 T A 12: 83,539,360 L367Q probably damaging Het
Dcc A T 18: 71,547,317 V616D probably benign Het
Dennd4a G A 9: 64,910,123 D1680N possibly damaging Het
Dgkq C G 5: 108,649,661 E788D possibly damaging Het
Dpep2 T C 8: 105,985,482 E282G probably benign Het
Gm14124 T G 2: 150,269,442 V684G possibly damaging Het
Gm8221 T A 15: 77,626,045 noncoding transcript Het
Ice1 T C 13: 70,609,027 S280G possibly damaging Het
Lrrc2 A T 9: 110,962,645 Q155L probably benign Het
Mesd G A 7: 83,897,977 R216Q probably benign Het
Msh6 T A 17: 87,980,269 N112K probably damaging Het
Nod1 T A 6: 54,943,996 N446Y probably damaging Het
Nrap G A 19: 56,351,481 T787I probably damaging Het
P2ry12 A G 3: 59,217,657 I199T probably damaging Het
Prr11 T G 11: 87,098,707 K279N possibly damaging Het
Psg25 C T 7: 18,524,891 E287K possibly damaging Het
Rusc1 T C 3: 89,092,308 S56G probably benign Het
Slc16a7 T C 10: 125,228,187 N427S probably damaging Het
Slc47a1 T A 11: 61,359,529 I341L probably benign Het
Slc9a8 T A 2: 167,424,193 L30Q probably benign Het
Ssh2 T A 11: 77,393,067 L49* probably null Het
Stard9 T A 2: 120,700,241 D2326E probably benign Het
Thbs1 T C 2: 118,119,950 I688T possibly damaging Het
Ttn T A 2: 76,916,478 E4742D probably benign Het
Vps37b T C 5: 124,007,626 I117V probably damaging Het
Xirp2 A T 2: 67,513,438 M2008L probably benign Het
Zfp53 A G 17: 21,509,235 E510G probably damaging Het
Zswim8 T A 14: 20,714,297 S578R probably benign Het
Other mutations in Myo15b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Myo15b APN 11 115891916 missense possibly damaging 0.69
IGL01409:Myo15b APN 11 115869504 nonsense probably null
IGL01539:Myo15b APN 11 115863473 missense probably benign 0.43
IGL01895:Myo15b APN 11 115883498 missense possibly damaging 0.77
IGL02254:Myo15b APN 11 115886283 missense probably damaging 1.00
IGL02343:Myo15b APN 11 115873400 unclassified probably benign
IGL02349:Myo15b APN 11 115863105 splice site probably benign
IGL02368:Myo15b APN 11 115877002 missense probably benign 0.13
IGL02576:Myo15b APN 11 115890053 missense probably null 0.97
IGL02650:Myo15b APN 11 115886511 critical splice donor site probably null
IGL02661:Myo15b APN 11 115884069 missense probably benign 0.01
IGL02716:Myo15b APN 11 115883709 missense probably benign 0.06
IGL02733:Myo15b APN 11 115884250 missense probably benign 0.00
IGL02951:Myo15b APN 11 115881301 missense probably damaging 1.00
IGL03017:Myo15b APN 11 115887917 missense possibly damaging 0.91
IGL03029:Myo15b APN 11 115871643 missense probably benign 0.08
ANU74:Myo15b UTSW 11 115878413 missense probably damaging 1.00
R0092:Myo15b UTSW 11 115862986 missense possibly damaging 0.90
R0255:Myo15b UTSW 11 115886283 missense probably damaging 1.00
R0325:Myo15b UTSW 11 115884265 missense probably damaging 1.00
R0614:Myo15b UTSW 11 115882913 missense probably damaging 1.00
R0652:Myo15b UTSW 11 115864642 missense probably benign 0.07
R0711:Myo15b UTSW 11 115883838 missense probably damaging 1.00
R0815:Myo15b UTSW 11 115866336 splice site probably benign
R0961:Myo15b UTSW 11 115882454 missense probably benign 0.15
R1066:Myo15b UTSW 11 115879751 missense probably benign 0.03
R1221:Myo15b UTSW 11 115886720 missense possibly damaging 0.75
R1240:Myo15b UTSW 11 115880501 missense possibly damaging 0.70
R1275:Myo15b UTSW 11 115883492 small deletion probably benign
R1313:Myo15b UTSW 11 115885129 missense probably damaging 1.00
R1313:Myo15b UTSW 11 115885129 missense probably damaging 1.00
R1317:Myo15b UTSW 11 115883634 missense probably null 0.14
R1491:Myo15b UTSW 11 115886857 splice site probably null
R1552:Myo15b UTSW 11 115866635 missense probably benign 0.08
R1731:Myo15b UTSW 11 115891560 missense possibly damaging 0.57
R1800:Myo15b UTSW 11 115880509 critical splice donor site probably null
R1843:Myo15b UTSW 11 115869586 missense probably benign 0.04
R1888:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1888:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1894:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1917:Myo15b UTSW 11 115882254 missense possibly damaging 0.51
R1934:Myo15b UTSW 11 115863484 missense probably benign 0.30
R1939:Myo15b UTSW 11 115887703 missense probably benign 0.00
R1945:Myo15b UTSW 11 115878398 missense probably damaging 1.00
R1986:Myo15b UTSW 11 115882875 missense probably benign 0.31
R2130:Myo15b UTSW 11 115871643 missense probably benign 0.08
R2138:Myo15b UTSW 11 115883807 missense probably benign 0.00
R2176:Myo15b UTSW 11 115866572 missense probably damaging 1.00
R2415:Myo15b UTSW 11 115879564 missense probably benign 0.00
R2483:Myo15b UTSW 11 115864739 missense probably benign 0.04
R3620:Myo15b UTSW 11 115871187 missense possibly damaging 0.46
R3716:Myo15b UTSW 11 115863413 missense probably benign 0.01
R4013:Myo15b UTSW 11 115871456 nonsense probably null
R4021:Myo15b UTSW 11 115873505 missense probably benign 0.07
R4119:Myo15b UTSW 11 115873492 missense probably benign 0.07
R4120:Myo15b UTSW 11 115873492 missense probably benign 0.07
R4653:Myo15b UTSW 11 115879987 critical splice donor site probably null
R4655:Myo15b UTSW 11 115890697 missense probably damaging 1.00
R4700:Myo15b UTSW 11 115861935 missense possibly damaging 0.55
R4702:Myo15b UTSW 11 115884008 missense probably benign 0.01
R4777:Myo15b UTSW 11 115879652 missense probably damaging 0.99
R4833:Myo15b UTSW 11 115887602 missense possibly damaging 0.51
R5083:Myo15b UTSW 11 115866656 missense probably benign 0.01
R5121:Myo15b UTSW 11 115886054 missense probably damaging 1.00
R5146:Myo15b UTSW 11 115891198 missense probably benign 0.00
R5535:Myo15b UTSW 11 115881301 missense probably damaging 1.00
R5647:Myo15b UTSW 11 115871511 missense probably damaging 0.99
R5849:Myo15b UTSW 11 115881933 missense probably damaging 1.00
R5882:Myo15b UTSW 11 115869596 missense probably damaging 1.00
R5956:Myo15b UTSW 11 115873757 missense probably benign 0.34
R6273:Myo15b UTSW 11 115862799 missense possibly damaging 0.63
R6302:Myo15b UTSW 11 115886239 missense possibly damaging 0.88
R6318:Myo15b UTSW 11 115890831 missense probably damaging 1.00
R6462:Myo15b UTSW 11 115859442 missense probably benign 0.01
R6792:Myo15b UTSW 11 115885097 missense probably damaging 1.00
X0020:Myo15b UTSW 11 115871799 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGCCCAGACCACTGTCAATG -3'
(R):5'- GACTATCAGCTTCCCTTGCAG -3'

Sequencing Primer
(F):5'- GAAACGCAGATTCTGTGCTG -3'
(R):5'- TTGCAGGTAGTCCCGAAGCAC -3'
Posted On2015-07-21