Incidental Mutation 'R0099:Dsg3'
ID33178
Institutional Source Beutler Lab
Gene Symbol Dsg3
Ensembl Gene ENSMUSG00000056632
Gene Namedesmoglein 3
Synonyms
MMRRC Submission 038385-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R0099 (G1)
Quality Score225
Status Validated (trace)
Chromosome18
Chromosomal Location20510304-20541310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20540022 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 917 (I917V)
Ref Sequence ENSEMBL: ENSMUSP00000064718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070892]
Predicted Effect probably benign
Transcript: ENSMUST00000070892
AA Change: I917V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000064718
Gene: ENSMUSG00000056632
AA Change: I917V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 3.9e-13 SMART
CA 179 265 2.36e-21 SMART
CA 288 382 1.55e-7 SMART
CA 409 493 6.15e-11 SMART
low complexity region 615 638 N/A INTRINSIC
low complexity region 643 657 N/A INTRINSIC
low complexity region 725 736 N/A INTRINSIC
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein exhibit loss of keratinocyte cell adhesion resulting in a phenotype that resembles that of patients with pemphigus vulgaris. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutants display runting from decreased food intake due to oropharyngeal epithelial lesions, blisters around snout and eyes, hair loss by weaning, and hair regrowth with bald patches throughout life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930018M24Rik C T 14: 50,896,722 probably benign Het
Acad10 A C 5: 121,621,290 D1043E probably damaging Het
Adamtsl4 C T 3: 95,684,139 G173R probably benign Het
Astn1 G T 1: 158,502,151 S192I probably damaging Het
Atg2a T A 19: 6,252,789 V1010E probably damaging Het
C130079G13Rik A C 3: 59,936,435 K183N probably benign Het
Col11a2 A G 17: 34,049,674 E311G probably damaging Het
Col4a3 A C 1: 82,717,993 E1638A probably benign Het
Cstf2t A G 19: 31,083,831 R256G probably benign Het
Cyp4a12a T C 4: 115,326,672 L225P probably damaging Het
Diexf A G 1: 193,128,470 L75P probably damaging Het
Dnah5 G A 15: 28,239,934 R479H probably damaging Het
Fam76a G T 4: 132,910,787 probably benign Het
Fras1 T A 5: 96,614,917 probably null Het
Gli1 A G 10: 127,336,006 V293A probably damaging Het
Gm10782 T A 13: 56,363,143 noncoding transcript Het
Greb1l A G 18: 10,509,158 E490G probably damaging Het
Hydin G A 8: 110,589,561 G4362R probably damaging Het
Ica1 A T 6: 8,749,778 probably benign Het
Ikzf4 T A 10: 128,634,197 I485F probably damaging Het
Irf5 A G 6: 29,533,967 T34A probably damaging Het
Krt81 A T 15: 101,463,521 C59* probably null Het
Kynu T A 2: 43,629,053 probably null Het
Ly6g6c T C 17: 35,068,915 V61A probably damaging Het
Manea A C 4: 26,328,104 I312M probably damaging Het
Micall1 G T 15: 79,131,901 probably benign Het
Mthfs A T 9: 89,226,163 probably benign Het
Myh4 A G 11: 67,259,347 T1877A probably benign Het
Myo3a T C 2: 22,245,598 I92T probably benign Het
Nepn A G 10: 52,401,085 S306G probably damaging Het
Nol8 T C 13: 49,672,689 V995A probably benign Het
Olfr1453 A G 19: 13,027,801 F176S probably damaging Het
Olfr1458 T A 19: 13,103,140 T49S probably benign Het
Olfr160 A T 9: 37,711,454 V275E probably damaging Het
Olfr967 A G 9: 39,750,661 I92V possibly damaging Het
Pde1a T A 2: 79,868,313 probably null Het
Phf14 A G 6: 11,987,697 probably benign Het
Plekhh2 C T 17: 84,591,672 Q1026* probably null Het
Polr2b T A 5: 77,320,950 probably benign Het
Ppp1r36 G T 12: 76,436,282 probably null Het
Prdm14 A T 1: 13,118,945 C392S probably damaging Het
Rabgap1l A G 1: 160,682,116 S436P possibly damaging Het
Rfc2 A T 5: 134,595,281 probably null Het
Rfx4 A T 10: 84,894,304 M437L probably benign Het
Rgs17 T A 10: 5,842,583 R74S probably benign Het
Rnf139 C A 15: 58,899,415 L430I probably damaging Het
Sgsm1 C A 5: 113,274,360 probably benign Het
Skint6 T A 4: 112,811,501 T1126S possibly damaging Het
Slc15a2 T C 16: 36,753,036 E602G probably damaging Het
Stpg2 T C 3: 139,243,193 probably benign Het
Sycp2l T C 13: 41,129,525 probably benign Het
Tlr11 A T 14: 50,360,818 N87I probably benign Het
Tril A G 6: 53,818,363 F625L probably damaging Het
Ube3c T A 5: 29,607,064 V434E probably damaging Het
Usp34 G A 11: 23,363,111 G533R probably damaging Het
Zfp93 G T 7: 24,275,475 R295L probably benign Het
Other mutations in Dsg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Dsg3 APN 18 20539654 missense probably damaging 1.00
IGL00697:Dsg3 APN 18 20524689 critical splice donor site probably null
IGL00966:Dsg3 APN 18 20523607 missense probably benign 0.02
IGL01352:Dsg3 APN 18 20523696 missense probably benign 0.25
IGL01953:Dsg3 APN 18 20525304 missense probably damaging 1.00
IGL02385:Dsg3 APN 18 20527714 missense probably damaging 1.00
IGL02622:Dsg3 APN 18 20528947 splice site probably benign
IGL02643:Dsg3 APN 18 20528955 missense probably benign 0.00
IGL02740:Dsg3 APN 18 20527708 missense possibly damaging 0.93
IGL03012:Dsg3 APN 18 20537243 critical splice acceptor site probably null
IGL03026:Dsg3 APN 18 20536972 splice site probably null
IGL03063:Dsg3 APN 18 20533368 splice site probably benign
IGL03098:Dsg3 APN 18 20510365 utr 5 prime probably benign
IGL03132:Dsg3 APN 18 20524596 missense probably damaging 1.00
IGL03352:Dsg3 APN 18 20527632 missense probably benign
P0035:Dsg3 UTSW 18 20539969 missense probably benign 0.05
R0039:Dsg3 UTSW 18 20521484 missense probably benign 0.36
R0109:Dsg3 UTSW 18 20540134 missense probably damaging 0.96
R0109:Dsg3 UTSW 18 20540134 missense probably damaging 0.96
R0143:Dsg3 UTSW 18 20536825 missense probably damaging 1.00
R0194:Dsg3 UTSW 18 20540142 missense probably damaging 1.00
R0373:Dsg3 UTSW 18 20539747 missense probably damaging 1.00
R0517:Dsg3 UTSW 18 20529025 missense probably benign 0.06
R0521:Dsg3 UTSW 18 20527815 missense possibly damaging 0.53
R1194:Dsg3 UTSW 18 20525220 missense probably damaging 0.98
R1551:Dsg3 UTSW 18 20536918 missense possibly damaging 0.84
R1762:Dsg3 UTSW 18 20539732 missense probably damaging 1.00
R1957:Dsg3 UTSW 18 20522105 missense probably damaging 1.00
R2061:Dsg3 UTSW 18 20527737 nonsense probably null
R2071:Dsg3 UTSW 18 20536825 missense probably damaging 1.00
R2513:Dsg3 UTSW 18 20523662 missense possibly damaging 0.48
R2571:Dsg3 UTSW 18 20540005 missense probably benign 0.01
R2945:Dsg3 UTSW 18 20539935 missense probably benign
R2968:Dsg3 UTSW 18 20525225 missense possibly damaging 0.75
R3906:Dsg3 UTSW 18 20538499 missense probably damaging 1.00
R4616:Dsg3 UTSW 18 20531559 missense probably benign
R4641:Dsg3 UTSW 18 20520558 missense probably benign 0.28
R4685:Dsg3 UTSW 18 20539736 missense probably benign 0.08
R5690:Dsg3 UTSW 18 20522051 missense probably benign 0.01
R5786:Dsg3 UTSW 18 20521571 missense possibly damaging 0.46
R5950:Dsg3 UTSW 18 20538529 missense probably damaging 1.00
R6131:Dsg3 UTSW 18 20538512 missense probably damaging 0.99
R6131:Dsg3 UTSW 18 20520477 splice site probably null
R6243:Dsg3 UTSW 18 20539724 missense probably damaging 1.00
R6315:Dsg3 UTSW 18 20524586 missense probably benign 0.08
R6327:Dsg3 UTSW 18 20539870 missense probably benign
R6418:Dsg3 UTSW 18 20523760 critical splice donor site probably null
R6464:Dsg3 UTSW 18 20533526 missense probably benign 0.00
R6497:Dsg3 UTSW 18 20537248 missense probably benign 0.33
R6518:Dsg3 UTSW 18 20533422 missense probably benign 0.23
R6551:Dsg3 UTSW 18 20539911 missense unknown
R6685:Dsg3 UTSW 18 20520615 critical splice donor site probably null
R6952:Dsg3 UTSW 18 20525159 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TTTGCCGATGACCTAGACGACAAC -3'
(R):5'- TCTGTGGGAGCCACTATACTGCTG -3'

Sequencing Primer
(F):5'- TGACCTAGACGACAACTTCTTGG -3'
(R):5'- CTATACTGCTGGAGGCACTAGG -3'
Posted On2013-05-09