Incidental Mutation 'R4502:Arf5'
ID331851
Institutional Source Beutler Lab
Gene Symbol Arf5
Ensembl Gene ENSMUSG00000020440
Gene NameADP-ribosylation factor 5
Synonyms
MMRRC Submission 041754-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R4502 (G1)
Quality Score152
Status Not validated
Chromosome6
Chromosomal Location28423560-28426602 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28425776 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 123 (V123A)
Ref Sequence ENSEMBL: ENSMUSP00000127281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020717] [ENSMUST00000031719] [ENSMUST00000064377] [ENSMUST00000090511] [ENSMUST00000169841] [ENSMUST00000170767]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020717
AA Change: V123A

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020717
Gene: ENSMUSG00000020440
AA Change: V123A

DomainStartEndE-ValueType
ARF 1 180 5.83e-121 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000031719
SMART Domains Protein: ENSMUSP00000031719
Gene: ENSMUSG00000029707

DomainStartEndE-ValueType
Pfam:Fascin 24 138 1e-29 PFAM
SCOP:d1dfca2 146 260 2e-48 SMART
Pfam:Fascin 271 381 2.1e-26 PFAM
SCOP:d1dfca4 386 498 3e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064377
SMART Domains Protein: ENSMUSP00000067395
Gene: ENSMUSG00000029708

DomainStartEndE-ValueType
coiled coil region 13 61 N/A INTRINSIC
low complexity region 93 109 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
coiled coil region 156 315 N/A INTRINSIC
low complexity region 408 418 N/A INTRINSIC
low complexity region 432 443 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
Blast:H2B 492 590 3e-8 BLAST
low complexity region 613 631 N/A INTRINSIC
coiled coil region 659 701 N/A INTRINSIC
Grip 719 766 8.28e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090511
SMART Domains Protein: ENSMUSP00000087997
Gene: ENSMUSG00000029708

DomainStartEndE-ValueType
coiled coil region 13 61 N/A INTRINSIC
low complexity region 93 109 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
coiled coil region 156 315 N/A INTRINSIC
low complexity region 408 418 N/A INTRINSIC
low complexity region 432 443 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
Blast:H2B 492 590 3e-8 BLAST
low complexity region 613 631 N/A INTRINSIC
coiled coil region 659 701 N/A INTRINSIC
Grip 719 766 8.28e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165455
SMART Domains Protein: ENSMUSP00000132415
Gene: ENSMUSG00000029708

DomainStartEndE-ValueType
coiled coil region 5 162 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169841
AA Change: V123A

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127281
Gene: ENSMUSG00000020440
AA Change: V123A

DomainStartEndE-ValueType
ARF 1 180 5.83e-121 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202028
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the human ADP-ribosylation factor (ARF) gene family. These genes encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. The gene products include 6 ARF proteins and 11 ARF-like proteins and constitute 1 family of the RAS superfamily. The ARF proteins are categorized as class I (ARF1, ARF2,and ARF3), class II (ARF4 and ARF5) and class III (ARF6). The members of each class share a common gene organization. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b A C 3: 20,315,798 Y215D probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atm A G 9: 53,495,946 V1164A possibly damaging Het
Atp6v0d1 A G 8: 105,565,798 C39R probably damaging Het
Bmp8a T A 4: 123,342,399 S104C probably damaging Het
Cand1 T C 10: 119,216,667 T185A probably benign Het
Ccdc171 A G 4: 83,864,323 E1284G probably damaging Het
Chodl A G 16: 78,931,444 S26G possibly damaging Het
Cic C T 7: 25,288,467 P620S probably damaging Het
Col3a1 T C 1: 45,348,677 probably benign Het
Dirc2 T C 16: 35,719,417 M345V probably benign Het
Dpyd G T 3: 118,797,537 G225C probably damaging Het
Dst G A 1: 34,247,691 V5560M probably damaging Het
Eea1 G A 10: 96,039,565 E1233K probably benign Het
Fryl T C 5: 73,088,397 D1139G probably damaging Het
Gpr39 G A 1: 125,677,991 V219I probably benign Het
Hc T C 2: 35,006,252 D1173G probably benign Het
Htr2a T A 14: 74,641,988 M19K probably benign Het
Kank4 G A 4: 98,777,098 S653L possibly damaging Het
Kcnt2 G T 1: 140,507,747 C484F probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Klhl1 A G 14: 96,517,846 S158P probably benign Het
Ldb2 T C 5: 44,669,407 D62G probably damaging Het
Ldhb T C 6: 142,490,457 K329E possibly damaging Het
Mtmr7 T C 8: 40,558,162 E285G possibly damaging Het
Olfr1370 A T 13: 21,072,746 I185N probably damaging Het
Olfr178 T C 16: 58,890,176 I15V probably benign Het
Olfr303 T A 7: 86,395,277 T74S possibly damaging Het
Pi4kb T A 3: 94,996,607 H501Q probably benign Het
Ppargc1b T C 18: 61,302,679 K910R probably benign Het
Ppp1r12a G T 10: 108,249,478 R428I probably benign Het
Rbbp8nl G T 2: 180,279,196 T465N possibly damaging Het
Rpl5 T C 5: 107,904,857 F223S possibly damaging Het
Scpep1 T C 11: 88,944,385 K154R probably benign Het
Sil1 T C 18: 35,317,875 Y249C probably benign Het
Slc12a1 T A 2: 125,226,044 L1017Q probably damaging Het
Slc2a9 T C 5: 38,398,811 N264S probably benign Het
Tdrd5 T A 1: 156,300,764 M141L probably benign Het
Tdrd9 T C 12: 111,993,825 C182R probably damaging Het
Thap4 T C 1: 93,750,987 probably null Het
Tmem131 T C 1: 36,825,479 T558A probably benign Het
Tnks1bp1 C T 2: 85,062,647 R973* probably null Het
Ulk3 A G 9: 57,593,229 Y307C probably damaging Het
Usp25 T C 16: 77,115,396 L1001P probably damaging Het
Vmn2r80 A T 10: 79,148,930 T39S probably benign Het
Vps33b G A 7: 80,287,907 A468T possibly damaging Het
Wnt9a T C 11: 59,328,537 S130P probably damaging Het
Zfp236 T C 18: 82,636,954 E730G probably benign Het
Zfp689 C A 7: 127,448,753 V36L probably benign Het
Zfp938 A G 10: 82,226,271 S172P possibly damaging Het
Other mutations in Arf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02667:Arf5 APN 6 28425199 missense probably damaging 1.00
R0115:Arf5 UTSW 6 28426076 missense probably damaging 1.00
R0481:Arf5 UTSW 6 28426076 missense probably damaging 1.00
R1498:Arf5 UTSW 6 28426154 missense probably benign 0.13
R1550:Arf5 UTSW 6 28426153 missense probably damaging 0.97
R2114:Arf5 UTSW 6 28424784 nonsense probably null
R2115:Arf5 UTSW 6 28424784 nonsense probably null
R2117:Arf5 UTSW 6 28424784 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGACGTTCAGCAATGAACTACAC -3'
(R):5'- TCCTTGTGCTAAGCAAAGATGAC -3'

Sequencing Primer
(F):5'- CAGTTCACTGTCTTTTTCCTACAAAG -3'
(R):5'- GCTATTTCTCTTTAGCATAGACAACC -3'
Posted On2015-07-21