Incidental Mutation 'R0101:Fndc3b'
ID33186
Institutional Source Beutler Lab
Gene Symbol Fndc3b
Ensembl Gene ENSMUSG00000039286
Gene Namefibronectin type III domain containing 3B
Synonymsfad104, 1600019O04Rik
MMRRC Submission 038387-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0101 (G1)
Quality Score100
Status Validated
Chromosome3
Chromosomal Location27416162-27711307 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27458808 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 723 (V723A)
Ref Sequence ENSEMBL: ENSMUSP00000141620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046157] [ENSMUST00000195008]
Predicted Effect probably damaging
Transcript: ENSMUST00000046157
AA Change: V723A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041495
Gene: ENSMUSG00000039286
AA Change: V723A

DomainStartEndE-ValueType
low complexity region 119 132 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
low complexity region 224 246 N/A INTRINSIC
FN3 279 368 6.29e-8 SMART
FN3 382 463 8.31e-8 SMART
FN3 478 560 3.15e-8 SMART
FN3 575 659 4.28e-10 SMART
FN3 674 755 2.14e-10 SMART
FN3 770 849 1.98e-5 SMART
FN3 872 947 1.31e-5 SMART
FN3 961 1042 2.31e-6 SMART
FN3 1057 1137 1.2e-4 SMART
low complexity region 1165 1176 N/A INTRINSIC
transmembrane domain 1182 1204 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195008
AA Change: V723A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141620
Gene: ENSMUSG00000039286
AA Change: V723A

DomainStartEndE-ValueType
low complexity region 119 132 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
low complexity region 224 246 N/A INTRINSIC
FN3 279 368 6.29e-8 SMART
FN3 382 463 8.31e-8 SMART
FN3 478 560 3.15e-8 SMART
FN3 575 659 4.28e-10 SMART
FN3 674 755 2.14e-10 SMART
FN3 770 849 1.98e-5 SMART
FN3 872 947 1.31e-5 SMART
FN3 961 1042 2.31e-6 SMART
FN3 1057 1137 1.2e-4 SMART
low complexity region 1165 1176 N/A INTRINSIC
transmembrane domain 1182 1204 N/A INTRINSIC
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die shortly after birth despite normal energy homeostasis. Mouse embryonic fibroblasts homozygous for a knock-out allele exhibit impaired adipogenesis and enhanced osteogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,220,960 C1844S probably benign Het
Aatk C T 11: 120,010,913 D829N probably benign Het
B3galnt1 A G 3: 69,575,806 Y41H probably benign Het
Carmil3 A C 14: 55,497,755 probably benign Het
Cdh17 A G 4: 11,771,341 Q41R probably benign Het
Chrm2 G T 6: 36,524,495 C429F probably damaging Het
Cyld T A 8: 88,718,300 probably null Het
Cyp2d11 C A 15: 82,390,194 probably benign Het
Dnah1 A G 14: 31,283,899 Y2308H probably damaging Het
Dnajc27 T C 12: 4,089,142 V60A probably benign Het
Dnmbp A G 19: 43,874,160 V850A possibly damaging Het
Emcn A T 3: 137,341,240 M1L possibly damaging Het
Epc1 A T 18: 6,462,998 probably benign Het
Fbxo21 T C 5: 117,995,456 L310P probably damaging Het
Fgfr1op A T 17: 8,169,542 S76C possibly damaging Het
Filip1 A G 9: 79,819,528 I603T probably benign Het
Gemin5 G A 11: 58,145,496 P674S probably damaging Het
Gsk3a T C 7: 25,228,903 D471G probably benign Het
Igbp1b G A 6: 138,657,660 P262L probably damaging Het
Itga11 T C 9: 62,744,486 L300S probably damaging Het
Itsn2 T C 12: 4,633,058 probably benign Het
Lhcgr A G 17: 88,765,170 S150P probably damaging Het
Man1a T C 10: 54,075,024 M1V probably null Het
Mical2 C T 7: 112,336,867 R892C possibly damaging Het
Mtus2 T C 5: 148,083,035 S747P probably damaging Het
Mug1 A G 6: 121,884,247 K1276E possibly damaging Het
Olfr353 A G 2: 36,890,126 S241P probably damaging Het
Pfkfb4 C G 9: 109,010,643 P260R probably benign Het
Prkca A T 11: 108,057,800 L121Q probably damaging Het
Prpf40b T C 15: 99,306,800 probably benign Het
Ripor2 T C 13: 24,680,632 M215T probably damaging Het
Rpn1 A G 6: 88,093,787 D213G possibly damaging Het
Rreb1 C A 13: 37,931,542 P959Q probably benign Het
Sema5b T C 16: 35,663,102 probably benign Het
Slc38a10 A G 11: 120,151,077 M1T probably null Het
Slco1c1 G T 6: 141,531,510 L11F probably damaging Het
Spef2 T C 15: 9,713,108 T393A probably damaging Het
Srp54b A G 12: 55,255,620 probably benign Het
St14 G T 9: 31,097,107 N512K probably benign Het
Syce1l T A 8: 113,655,429 S237T probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tamm41 A T 6: 115,032,246 Y129N probably damaging Het
Tctn2 T C 5: 124,615,294 noncoding transcript Het
Tpr T C 1: 150,409,302 probably benign Het
Vsig10 T A 5: 117,335,069 probably null Het
Zfp335 T C 2: 164,899,990 K635R probably damaging Het
Zfp541 A G 7: 16,078,043 Y207C probably damaging Het
Other mutations in Fndc3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Fndc3b APN 3 27538012 missense probably benign 0.40
IGL00848:Fndc3b APN 3 27451509 missense probably damaging 1.00
IGL01099:Fndc3b APN 3 27463817 missense probably benign 0.10
IGL01459:Fndc3b APN 3 27461740 missense probably benign 0.11
IGL01583:Fndc3b APN 3 27428995 missense probably damaging 1.00
IGL01736:Fndc3b APN 3 27467403 missense probably damaging 1.00
IGL02154:Fndc3b APN 3 27538117 missense probably damaging 0.99
IGL02377:Fndc3b APN 3 27620652 missense probably damaging 1.00
IGL02470:Fndc3b APN 3 27461720 missense probably damaging 1.00
IGL02508:Fndc3b APN 3 27458751 missense probably damaging 1.00
IGL02834:Fndc3b APN 3 27508503 missense probably damaging 1.00
IGL02974:Fndc3b APN 3 27488276 missense probably damaging 1.00
IGL02999:Fndc3b APN 3 27538239 missense probably damaging 1.00
IGL03083:Fndc3b APN 3 27467427 missense probably benign 0.10
R0040:Fndc3b UTSW 3 27556117 splice site probably null
R0040:Fndc3b UTSW 3 27556117 splice site probably null
R0279:Fndc3b UTSW 3 27457006 missense probably benign 0.30
R0281:Fndc3b UTSW 3 27457006 missense probably benign 0.30
R0325:Fndc3b UTSW 3 27467430 missense probably damaging 1.00
R0398:Fndc3b UTSW 3 27461779 missense probably benign 0.19
R1334:Fndc3b UTSW 3 27458851 missense probably damaging 1.00
R1464:Fndc3b UTSW 3 27440185 splice site probably benign
R1961:Fndc3b UTSW 3 27456451 nonsense probably null
R1993:Fndc3b UTSW 3 27419400 missense probably benign
R2087:Fndc3b UTSW 3 27451554 missense probably benign 0.00
R2113:Fndc3b UTSW 3 27643036 missense probably damaging 1.00
R2258:Fndc3b UTSW 3 27440160 missense possibly damaging 0.93
R2437:Fndc3b UTSW 3 27451332 missense probably damaging 0.99
R2930:Fndc3b UTSW 3 27470286 missense probably benign
R2997:Fndc3b UTSW 3 27468872 missense probably benign 0.00
R3151:Fndc3b UTSW 3 27419503 missense possibly damaging 0.93
R3782:Fndc3b UTSW 3 27459986 missense possibly damaging 0.81
R4255:Fndc3b UTSW 3 27501407 missense possibly damaging 0.77
R4628:Fndc3b UTSW 3 27556128 missense probably benign 0.19
R4747:Fndc3b UTSW 3 27428965 missense probably damaging 0.98
R4849:Fndc3b UTSW 3 27459948 missense probably damaging 1.00
R5185:Fndc3b UTSW 3 27457070 missense probably benign 0.14
R5291:Fndc3b UTSW 3 27642995 missense probably benign 0.39
R5392:Fndc3b UTSW 3 27465787 nonsense probably null
R5540:Fndc3b UTSW 3 27501502 missense probably damaging 1.00
R5554:Fndc3b UTSW 3 27643013 missense possibly damaging 0.69
R5635:Fndc3b UTSW 3 27541931 missense probably damaging 1.00
R5639:Fndc3b UTSW 3 27426153 missense probably damaging 0.98
R5678:Fndc3b UTSW 3 27429023 missense probably benign
R5732:Fndc3b UTSW 3 27461773 missense probably damaging 1.00
R5880:Fndc3b UTSW 3 27428903 missense probably damaging 1.00
R6539:Fndc3b UTSW 3 27538057 missense probably benign 0.22
R7038:Fndc3b UTSW 3 27501469 missense probably benign 0.23
R7102:Fndc3b UTSW 3 27470234 missense possibly damaging 0.73
R7203:Fndc3b UTSW 3 27456485 missense probably benign 0.00
X0028:Fndc3b UTSW 3 27451434 missense possibly damaging 0.72
Z1088:Fndc3b UTSW 3 27465808 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GTCACATACAACTGAGAGGTTGCAGG -3'
(R):5'- TCATGTAGACTTAGCAGGGTGTCTCAC -3'

Sequencing Primer
(F):5'- GAGGCTAACAAAGGCACCTTG -3'
(R):5'- ggagagacgggcagtgg -3'
Posted On2013-05-09