Incidental Mutation 'R4502:Ppp1r12a'
ID331866
Institutional Source Beutler Lab
Gene Symbol Ppp1r12a
Ensembl Gene ENSMUSG00000019907
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 12A
Synonyms1200015F06Rik, 5730577I22Rik, Mypt1, D10Ertd625e
MMRRC Submission 041754-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4502 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location108162193-108284475 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 108249478 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Isoleucine at position 428 (R428I)
Ref Sequence ENSEMBL: ENSMUSP00000151842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070663] [ENSMUST00000219263] [ENSMUST00000219759]
Predicted Effect probably benign
Transcript: ENSMUST00000070663
AA Change: R428I

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000069257
Gene: ENSMUSG00000019907
AA Change: R428I

DomainStartEndE-ValueType
ANK 38 68 1.01e2 SMART
ANK 72 101 1.66e-6 SMART
ANK 105 134 6.36e-3 SMART
ANK 138 168 5.52e2 SMART
ANK 198 227 6.12e-5 SMART
ANK 231 260 5.16e-3 SMART
coiled coil region 333 354 N/A INTRINSIC
low complexity region 385 402 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
low complexity region 517 531 N/A INTRINSIC
low complexity region 564 578 N/A INTRINSIC
low complexity region 596 610 N/A INTRINSIC
low complexity region 626 656 N/A INTRINSIC
PDB:2KJY|A 657 712 5e-12 PDB
low complexity region 719 745 N/A INTRINSIC
low complexity region 771 794 N/A INTRINSIC
low complexity region 815 833 N/A INTRINSIC
low complexity region 836 851 N/A INTRINSIC
low complexity region 883 902 N/A INTRINSIC
Pfam:PRKG1_interact 930 993 4.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219068
Predicted Effect probably benign
Transcript: ENSMUST00000219263
AA Change: R428I

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000219759
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin phosphatase target subunit 1, which is also called the myosin-binding subunit of myosin phosphatase, is one of the subunits of myosin phosphatase. Myosin phosphatase regulates the interaction of actin and myosin downstream of the guanosine triphosphatase Rho. The small guanosine triphosphatase Rho is implicated in myosin light chain (MLC) phosphorylation, which results in contraction of smooth muscle and interaction of actin and myosin in nonmuscle cells. The guanosine triphosphate (GTP)-bound, active form of RhoA (GTP.RhoA) specifically interacted with the myosin-binding subunit (MBS) of myosin phosphatase, which regulates the extent of phosphorylation of MLC. Rho-associated kinase (Rho-kinase), which is activated by GTP. RhoA, phosphorylated MBS and consequently inactivated myosin phosphatase. Overexpression of RhoA or activated RhoA in NIH 3T3 cells increased phosphorylation of MBS and MLC. Thus, Rho appears to inhibit myosin phosphatase through the action of Rho-kinase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous null mice die before E7.5. Mice homozygous for a floxed allele activated in smooth muscle exhibit altered intestinal smooth muscle contractility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b A C 3: 20,315,798 Y215D probably damaging Het
Arf5 T C 6: 28,425,776 V123A possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atm A G 9: 53,495,946 V1164A possibly damaging Het
Atp6v0d1 A G 8: 105,565,798 C39R probably damaging Het
Bmp8a T A 4: 123,342,399 S104C probably damaging Het
Cand1 T C 10: 119,216,667 T185A probably benign Het
Ccdc171 A G 4: 83,864,323 E1284G probably damaging Het
Chodl A G 16: 78,931,444 S26G possibly damaging Het
Cic C T 7: 25,288,467 P620S probably damaging Het
Col3a1 T C 1: 45,348,677 probably benign Het
Dirc2 T C 16: 35,719,417 M345V probably benign Het
Dpyd G T 3: 118,797,537 G225C probably damaging Het
Dst G A 1: 34,247,691 V5560M probably damaging Het
Eea1 G A 10: 96,039,565 E1233K probably benign Het
Fryl T C 5: 73,088,397 D1139G probably damaging Het
Gpr39 G A 1: 125,677,991 V219I probably benign Het
Hc T C 2: 35,006,252 D1173G probably benign Het
Htr2a T A 14: 74,641,988 M19K probably benign Het
Kank4 G A 4: 98,777,098 S653L possibly damaging Het
Kcnt2 G T 1: 140,507,747 C484F probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Klhl1 A G 14: 96,517,846 S158P probably benign Het
Ldb2 T C 5: 44,669,407 D62G probably damaging Het
Ldhb T C 6: 142,490,457 K329E possibly damaging Het
Mtmr7 T C 8: 40,558,162 E285G possibly damaging Het
Olfr1370 A T 13: 21,072,746 I185N probably damaging Het
Olfr178 T C 16: 58,890,176 I15V probably benign Het
Olfr303 T A 7: 86,395,277 T74S possibly damaging Het
Pi4kb T A 3: 94,996,607 H501Q probably benign Het
Ppargc1b T C 18: 61,302,679 K910R probably benign Het
Rbbp8nl G T 2: 180,279,196 T465N possibly damaging Het
Rpl5 T C 5: 107,904,857 F223S possibly damaging Het
Scpep1 T C 11: 88,944,385 K154R probably benign Het
Sil1 T C 18: 35,317,875 Y249C probably benign Het
Slc12a1 T A 2: 125,226,044 L1017Q probably damaging Het
Slc2a9 T C 5: 38,398,811 N264S probably benign Het
Tdrd5 T A 1: 156,300,764 M141L probably benign Het
Tdrd9 T C 12: 111,993,825 C182R probably damaging Het
Thap4 T C 1: 93,750,987 probably null Het
Tmem131 T C 1: 36,825,479 T558A probably benign Het
Tnks1bp1 C T 2: 85,062,647 R973* probably null Het
Ulk3 A G 9: 57,593,229 Y307C probably damaging Het
Usp25 T C 16: 77,115,396 L1001P probably damaging Het
Vmn2r80 A T 10: 79,148,930 T39S probably benign Het
Vps33b G A 7: 80,287,907 A468T possibly damaging Het
Wnt9a T C 11: 59,328,537 S130P probably damaging Het
Zfp236 T C 18: 82,636,954 E730G probably benign Het
Zfp689 C A 7: 127,448,753 V36L probably benign Het
Zfp938 A G 10: 82,226,271 S172P possibly damaging Het
Other mutations in Ppp1r12a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Ppp1r12a APN 10 108198848 missense probably damaging 1.00
IGL00727:Ppp1r12a APN 10 108230473 missense probably damaging 1.00
IGL00819:Ppp1r12a APN 10 108240821 missense probably damaging 0.98
IGL01538:Ppp1r12a APN 10 108234021 missense probably damaging 1.00
IGL02227:Ppp1r12a APN 10 108269324 missense probably damaging 1.00
IGL02957:Ppp1r12a APN 10 108198918 missense probably damaging 0.98
IGL03063:Ppp1r12a APN 10 108261254 missense probably damaging 1.00
IGL03260:Ppp1r12a APN 10 108261245 missense probably benign 0.10
R0049:Ppp1r12a UTSW 10 108253332 missense possibly damaging 0.63
R0268:Ppp1r12a UTSW 10 108273381 intron probably benign
R0826:Ppp1r12a UTSW 10 108230553 missense possibly damaging 0.46
R0839:Ppp1r12a UTSW 10 108198861 missense probably damaging 1.00
R1026:Ppp1r12a UTSW 10 108251859 missense probably benign 0.08
R1053:Ppp1r12a UTSW 10 108262351 missense probably damaging 1.00
R1376:Ppp1r12a UTSW 10 108198918 missense probably damaging 0.98
R1376:Ppp1r12a UTSW 10 108198918 missense probably damaging 0.98
R1511:Ppp1r12a UTSW 10 108251859 missense probably benign 0.08
R1616:Ppp1r12a UTSW 10 108260867 missense probably damaging 1.00
R1673:Ppp1r12a UTSW 10 108249565 missense probably damaging 0.96
R1866:Ppp1r12a UTSW 10 108262431 missense possibly damaging 0.85
R1901:Ppp1r12a UTSW 10 108198891 missense probably damaging 1.00
R1902:Ppp1r12a UTSW 10 108198891 missense probably damaging 1.00
R2233:Ppp1r12a UTSW 10 108198919 missense possibly damaging 0.83
R2234:Ppp1r12a UTSW 10 108198919 missense possibly damaging 0.83
R3760:Ppp1r12a UTSW 10 108264734 missense probably damaging 1.00
R3856:Ppp1r12a UTSW 10 108253501 intron probably benign
R3973:Ppp1r12a UTSW 10 108253480 missense probably benign 0.44
R3974:Ppp1r12a UTSW 10 108253480 missense probably benign 0.44
R3976:Ppp1r12a UTSW 10 108253480 missense probably benign 0.44
R4902:Ppp1r12a UTSW 10 108230590 missense probably damaging 1.00
R5092:Ppp1r12a UTSW 10 108267402 critical splice acceptor site probably null
R5224:Ppp1r12a UTSW 10 108261025 missense probably benign 0.37
R5353:Ppp1r12a UTSW 10 108261216 intron probably null
R5428:Ppp1r12a UTSW 10 108253347 missense possibly damaging 0.76
R5472:Ppp1r12a UTSW 10 108240112 missense probably damaging 1.00
R5510:Ppp1r12a UTSW 10 108249627 missense possibly damaging 0.82
R6217:Ppp1r12a UTSW 10 108240184 splice site probably null
R6274:Ppp1r12a UTSW 10 108260890 missense probably benign 0.00
R6431:Ppp1r12a UTSW 10 108262420 missense probably damaging 1.00
R6744:Ppp1r12a UTSW 10 108230534 missense probably damaging 1.00
R6838:Ppp1r12a UTSW 10 108261276 missense possibly damaging 0.76
R6865:Ppp1r12a UTSW 10 108262381 nonsense probably null
R6993:Ppp1r12a UTSW 10 108240837 missense probably benign 0.18
R7565:Ppp1r12a UTSW 10 108268640 missense probably benign 0.21
X0027:Ppp1r12a UTSW 10 108214423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTTACGACCTTAACCTTAG -3'
(R):5'- AGCTGATACCCAGGATCTAATGG -3'

Sequencing Primer
(F):5'- CCTTACGACCTTAACCTTAGTAAATG -3'
(R):5'- CCCAGGATCTAATGGTGCTTACTAG -3'
Posted On2015-07-21