Incidental Mutation 'R0101:B3galnt1'
ID33187
Institutional Source Beutler Lab
Gene Symbol B3galnt1
Ensembl Gene ENSMUSG00000043300
Gene NameUDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 1
SynonymsBrainiac 1, B3galt3, Globoside blood group, Mbrn 1
MMRRC Submission 038387-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R0101 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location69574158-69598960 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69575806 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 41 (Y41H)
Ref Sequence ENSEMBL: ENSMUSP00000058363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061826]
Predicted Effect probably benign
Transcript: ENSMUST00000061826
AA Change: Y41H

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000058363
Gene: ENSMUSG00000043300
AA Change: Y41H

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Galactosyl_T 92 285 4.5e-68 PFAM
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the beta-1,3-galactosyltransferase (beta3GalT) gene family. This family encodes type II membrane-bound glycoproteins with diverse enzymatic functions using different donor substrates (UDP-galactose and UDP-N-acetylglucosamine) and different acceptor sugars (N-acetylglucosamine, galactose, N-acetylgalactosamine). The beta3GalT genes are distantly related to the Drosophila Brainiac gene and have the protein coding sequence contained in a single exon. The beta3GalT proteins also contain conserved sequences not found in the beta4GalT or alpha3GalT proteins. The carbohydrate chains synthesized by these enzymes are designated as type 1, whereas beta4GalT enzymes synthesize type 2 carbohydrate chains. The ratio of type 1:type 2 chains changes during embryogenesis. By sequence similarity, the beta3GalT genes fall into at least two groups: beta3GalT4 and 4 other beta3GalT genes (beta3GalT1-3, beta3GalT5). The encoded protein of this gene does not use N-acetylglucosamine as an acceptor sugar at all. [provided by RefSeq, Mar 2017]
PHENOTYPE: A homozygous null mutation of this gene results in embryonic lethality. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,220,960 C1844S probably benign Het
Aatk C T 11: 120,010,913 D829N probably benign Het
Carmil3 A C 14: 55,497,755 probably benign Het
Cdh17 A G 4: 11,771,341 Q41R probably benign Het
Chrm2 G T 6: 36,524,495 C429F probably damaging Het
Cyld T A 8: 88,718,300 probably null Het
Cyp2d11 C A 15: 82,390,194 probably benign Het
Dnah1 A G 14: 31,283,899 Y2308H probably damaging Het
Dnajc27 T C 12: 4,089,142 V60A probably benign Het
Dnmbp A G 19: 43,874,160 V850A possibly damaging Het
Emcn A T 3: 137,341,240 M1L possibly damaging Het
Epc1 A T 18: 6,462,998 probably benign Het
Fbxo21 T C 5: 117,995,456 L310P probably damaging Het
Fgfr1op A T 17: 8,169,542 S76C possibly damaging Het
Filip1 A G 9: 79,819,528 I603T probably benign Het
Fndc3b A G 3: 27,458,808 V723A probably damaging Het
Gemin5 G A 11: 58,145,496 P674S probably damaging Het
Gsk3a T C 7: 25,228,903 D471G probably benign Het
Igbp1b G A 6: 138,657,660 P262L probably damaging Het
Itga11 T C 9: 62,744,486 L300S probably damaging Het
Itsn2 T C 12: 4,633,058 probably benign Het
Lhcgr A G 17: 88,765,170 S150P probably damaging Het
Man1a T C 10: 54,075,024 M1V probably null Het
Mical2 C T 7: 112,336,867 R892C possibly damaging Het
Mtus2 T C 5: 148,083,035 S747P probably damaging Het
Mug1 A G 6: 121,884,247 K1276E possibly damaging Het
Olfr353 A G 2: 36,890,126 S241P probably damaging Het
Pfkfb4 C G 9: 109,010,643 P260R probably benign Het
Prkca A T 11: 108,057,800 L121Q probably damaging Het
Prpf40b T C 15: 99,306,800 probably benign Het
Ripor2 T C 13: 24,680,632 M215T probably damaging Het
Rpn1 A G 6: 88,093,787 D213G possibly damaging Het
Rreb1 C A 13: 37,931,542 P959Q probably benign Het
Sema5b T C 16: 35,663,102 probably benign Het
Slc38a10 A G 11: 120,151,077 M1T probably null Het
Slco1c1 G T 6: 141,531,510 L11F probably damaging Het
Spef2 T C 15: 9,713,108 T393A probably damaging Het
Srp54b A G 12: 55,255,620 probably benign Het
St14 G T 9: 31,097,107 N512K probably benign Het
Syce1l T A 8: 113,655,429 S237T probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tamm41 A T 6: 115,032,246 Y129N probably damaging Het
Tctn2 T C 5: 124,615,294 noncoding transcript Het
Tpr T C 1: 150,409,302 probably benign Het
Vsig10 T A 5: 117,335,069 probably null Het
Zfp335 T C 2: 164,899,990 K635R probably damaging Het
Zfp541 A G 7: 16,078,043 Y207C probably damaging Het
Other mutations in B3galnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0230:B3galnt1 UTSW 3 69575340 missense possibly damaging 0.80
R1580:B3galnt1 UTSW 3 69575707 missense possibly damaging 0.95
R1628:B3galnt1 UTSW 3 69575628 missense probably damaging 1.00
R1942:B3galnt1 UTSW 3 69575925 start codon destroyed probably null 0.90
R5137:B3galnt1 UTSW 3 69574949 missense probably benign 0.01
R6418:B3galnt1 UTSW 3 69574993 missense probably damaging 1.00
R6468:B3galnt1 UTSW 3 69575533 missense probably damaging 1.00
R6473:B3galnt1 UTSW 3 69575340 missense possibly damaging 0.80
R7236:B3galnt1 UTSW 3 69575617 missense probably benign 0.36
R7363:B3galnt1 UTSW 3 69575824 missense probably damaging 1.00
R7501:B3galnt1 UTSW 3 69575299 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TCATCCTCCAAGGACAGGGCTAAC -3'
(R):5'- CCTGTAGAACCTGTGCCTTCTGAAC -3'

Sequencing Primer
(F):5'- CCAAGTAACTCTAATGGCTTGTCTG -3'
(R):5'- AACTTCTCTGCTGCTGTGGATG -3'
Posted On2013-05-09