Incidental Mutation 'R4502:Zfp236'
ID331881
Institutional Source Beutler Lab
Gene Symbol Zfp236
Ensembl Gene ENSMUSG00000041258
Gene Namezinc finger protein 236
SynonymsLOC240456
MMRRC Submission 041754-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.719) question?
Stock #R4502 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location82593593-82692883 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82636954 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 730 (E730G)
Ref Sequence ENSEMBL: ENSMUSP00000130004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171071] [ENSMUST00000182122] [ENSMUST00000183048]
Predicted Effect probably benign
Transcript: ENSMUST00000171071
AA Change: E730G

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000130004
Gene: ENSMUSG00000041258
AA Change: E730G

DomainStartEndE-ValueType
ZnF_C2H2 39 61 2.24e-3 SMART
ZnF_C2H2 68 90 2.29e0 SMART
ZnF_C2H2 95 117 1.26e-2 SMART
ZnF_C2H2 123 145 6.67e-2 SMART
ZnF_C2H2 155 177 6.42e-4 SMART
ZnF_C2H2 199 221 1.75e-5 SMART
ZnF_C2H2 227 249 1.52e-5 SMART
ZnF_C2H2 255 278 8.94e-3 SMART
low complexity region 290 309 N/A INTRINSIC
low complexity region 403 426 N/A INTRINSIC
ZnF_C2H2 436 458 1.98e-4 SMART
ZnF_C2H2 464 486 9.58e-3 SMART
ZnF_C2H2 492 514 6.42e-4 SMART
ZnF_C2H2 520 542 1.18e-2 SMART
low complexity region 592 605 N/A INTRINSIC
ZnF_C2H2 611 633 1.62e0 SMART
ZnF_C2H2 639 661 5.21e-4 SMART
ZnF_C2H2 667 689 6.78e-3 SMART
ZnF_C2H2 695 717 7.37e-4 SMART
low complexity region 720 733 N/A INTRINSIC
ZnF_C2H2 922 944 5.21e-4 SMART
ZnF_C2H2 950 972 1.04e-3 SMART
ZnF_C2H2 978 1000 8.6e-5 SMART
ZnF_C2H2 1006 1028 2.75e-3 SMART
low complexity region 1030 1039 N/A INTRINSIC
ZnF_C2H2 1122 1144 7.78e-3 SMART
ZnF_C2H2 1150 1172 3.63e-3 SMART
ZnF_C2H2 1178 1200 6.88e-4 SMART
ZnF_C2H2 1206 1228 5.42e-2 SMART
low complexity region 1243 1258 N/A INTRINSIC
low complexity region 1462 1477 N/A INTRINSIC
ZnF_C2H2 1612 1635 7.15e-2 SMART
ZnF_C2H2 1641 1663 2.91e-2 SMART
ZnF_C2H2 1677 1699 7.26e-3 SMART
ZnF_C2H2 1705 1727 1.84e-4 SMART
ZnF_C2H2 1733 1756 2.95e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182122
AA Change: E778G

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000138557
Gene: ENSMUSG00000041258
AA Change: E778G

DomainStartEndE-ValueType
ZnF_C2H2 39 61 2.24e-3 SMART
ZnF_C2H2 68 90 2.29e0 SMART
ZnF_C2H2 95 117 1.26e-2 SMART
ZnF_C2H2 123 145 6.67e-2 SMART
ZnF_C2H2 155 177 6.42e-4 SMART
ZnF_C2H2 199 221 1.75e-5 SMART
ZnF_C2H2 227 249 1.52e-5 SMART
ZnF_C2H2 255 278 8.94e-3 SMART
ZnF_C2H2 287 310 9.58e-3 SMART
low complexity region 338 357 N/A INTRINSIC
low complexity region 451 474 N/A INTRINSIC
ZnF_C2H2 484 506 1.98e-4 SMART
ZnF_C2H2 512 534 9.58e-3 SMART
ZnF_C2H2 540 562 6.42e-4 SMART
ZnF_C2H2 568 590 1.18e-2 SMART
low complexity region 640 653 N/A INTRINSIC
ZnF_C2H2 659 681 1.62e0 SMART
ZnF_C2H2 687 709 5.21e-4 SMART
ZnF_C2H2 715 737 6.78e-3 SMART
ZnF_C2H2 743 765 7.37e-4 SMART
low complexity region 768 781 N/A INTRINSIC
ZnF_C2H2 970 992 5.21e-4 SMART
ZnF_C2H2 998 1020 1.04e-3 SMART
ZnF_C2H2 1026 1048 8.6e-5 SMART
ZnF_C2H2 1054 1076 2.75e-3 SMART
low complexity region 1078 1087 N/A INTRINSIC
ZnF_C2H2 1170 1192 7.78e-3 SMART
ZnF_C2H2 1198 1220 3.63e-3 SMART
ZnF_C2H2 1226 1248 6.88e-4 SMART
ZnF_C2H2 1254 1276 5.42e-2 SMART
low complexity region 1291 1306 N/A INTRINSIC
low complexity region 1510 1525 N/A INTRINSIC
ZnF_C2H2 1660 1683 7.15e-2 SMART
ZnF_C2H2 1689 1711 2.91e-2 SMART
ZnF_C2H2 1725 1747 7.26e-3 SMART
ZnF_C2H2 1753 1775 1.84e-4 SMART
ZnF_C2H2 1781 1804 2.95e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182759
Predicted Effect probably benign
Transcript: ENSMUST00000183048
SMART Domains Protein: ENSMUSP00000138179
Gene: ENSMUSG00000041258

DomainStartEndE-ValueType
ZnF_C2H2 39 61 2.24e-3 SMART
ZnF_C2H2 68 90 2.29e0 SMART
ZnF_C2H2 95 117 1.26e-2 SMART
ZnF_C2H2 123 145 6.67e-2 SMART
ZnF_C2H2 155 177 6.42e-4 SMART
ZnF_C2H2 199 221 1.75e-5 SMART
ZnF_C2H2 227 249 1.52e-5 SMART
ZnF_C2H2 255 278 8.94e-3 SMART
ZnF_C2H2 287 310 9.58e-3 SMART
low complexity region 338 357 N/A INTRINSIC
low complexity region 454 467 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b A C 3: 20,315,798 Y215D probably damaging Het
Arf5 T C 6: 28,425,776 V123A possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atm A G 9: 53,495,946 V1164A possibly damaging Het
Atp6v0d1 A G 8: 105,565,798 C39R probably damaging Het
Bmp8a T A 4: 123,342,399 S104C probably damaging Het
Cand1 T C 10: 119,216,667 T185A probably benign Het
Ccdc171 A G 4: 83,864,323 E1284G probably damaging Het
Chodl A G 16: 78,931,444 S26G possibly damaging Het
Cic C T 7: 25,288,467 P620S probably damaging Het
Col3a1 T C 1: 45,348,677 probably benign Het
Dirc2 T C 16: 35,719,417 M345V probably benign Het
Dpyd G T 3: 118,797,537 G225C probably damaging Het
Dst G A 1: 34,247,691 V5560M probably damaging Het
Eea1 G A 10: 96,039,565 E1233K probably benign Het
Fryl T C 5: 73,088,397 D1139G probably damaging Het
Gpr39 G A 1: 125,677,991 V219I probably benign Het
Hc T C 2: 35,006,252 D1173G probably benign Het
Htr2a T A 14: 74,641,988 M19K probably benign Het
Kank4 G A 4: 98,777,098 S653L possibly damaging Het
Kcnt2 G T 1: 140,507,747 C484F probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Klhl1 A G 14: 96,517,846 S158P probably benign Het
Ldb2 T C 5: 44,669,407 D62G probably damaging Het
Ldhb T C 6: 142,490,457 K329E possibly damaging Het
Mtmr7 T C 8: 40,558,162 E285G possibly damaging Het
Olfr1370 A T 13: 21,072,746 I185N probably damaging Het
Olfr178 T C 16: 58,890,176 I15V probably benign Het
Olfr303 T A 7: 86,395,277 T74S possibly damaging Het
Pi4kb T A 3: 94,996,607 H501Q probably benign Het
Ppargc1b T C 18: 61,302,679 K910R probably benign Het
Ppp1r12a G T 10: 108,249,478 R428I probably benign Het
Rbbp8nl G T 2: 180,279,196 T465N possibly damaging Het
Rpl5 T C 5: 107,904,857 F223S possibly damaging Het
Scpep1 T C 11: 88,944,385 K154R probably benign Het
Sil1 T C 18: 35,317,875 Y249C probably benign Het
Slc12a1 T A 2: 125,226,044 L1017Q probably damaging Het
Slc2a9 T C 5: 38,398,811 N264S probably benign Het
Tdrd5 T A 1: 156,300,764 M141L probably benign Het
Tdrd9 T C 12: 111,993,825 C182R probably damaging Het
Thap4 T C 1: 93,750,987 probably null Het
Tmem131 T C 1: 36,825,479 T558A probably benign Het
Tnks1bp1 C T 2: 85,062,647 R973* probably null Het
Ulk3 A G 9: 57,593,229 Y307C probably damaging Het
Usp25 T C 16: 77,115,396 L1001P probably damaging Het
Vmn2r80 A T 10: 79,148,930 T39S probably benign Het
Vps33b G A 7: 80,287,907 A468T possibly damaging Het
Wnt9a T C 11: 59,328,537 S130P probably damaging Het
Zfp689 C A 7: 127,448,753 V36L probably benign Het
Zfp938 A G 10: 82,226,271 S172P possibly damaging Het
Other mutations in Zfp236
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Zfp236 APN 18 82668690 missense probably benign 0.44
IGL01760:Zfp236 APN 18 82621422 missense probably damaging 1.00
IGL01923:Zfp236 APN 18 82682219 missense probably damaging 0.98
IGL01934:Zfp236 APN 18 82633120 missense probably damaging 0.99
IGL01949:Zfp236 APN 18 82624396 missense probably damaging 1.00
IGL02063:Zfp236 APN 18 82658151 missense probably benign
IGL02496:Zfp236 APN 18 82629992 missense probably damaging 1.00
IGL02513:Zfp236 APN 18 82630114 missense probably damaging 1.00
IGL02626:Zfp236 APN 18 82657995 splice site probably benign
IGL02880:Zfp236 APN 18 82624459 missense probably benign 0.15
IGL03156:Zfp236 APN 18 82680702 missense probably damaging 1.00
IGL03261:Zfp236 APN 18 82630608 missense possibly damaging 0.93
R0047:Zfp236 UTSW 18 82680692 missense probably damaging 1.00
R0052:Zfp236 UTSW 18 82639332 missense probably damaging 1.00
R0194:Zfp236 UTSW 18 82656987 missense probably damaging 1.00
R0207:Zfp236 UTSW 18 82640227 missense probably damaging 1.00
R0234:Zfp236 UTSW 18 82629994 missense probably damaging 1.00
R0234:Zfp236 UTSW 18 82629994 missense probably damaging 1.00
R0302:Zfp236 UTSW 18 82658088 missense probably damaging 0.99
R0730:Zfp236 UTSW 18 82640244 splice site probably benign
R0755:Zfp236 UTSW 18 82620332 missense probably damaging 1.00
R1202:Zfp236 UTSW 18 82628166 missense probably benign 0.00
R1449:Zfp236 UTSW 18 82646005 missense probably damaging 1.00
R1550:Zfp236 UTSW 18 82674424 missense possibly damaging 0.81
R1785:Zfp236 UTSW 18 82621304 missense probably benign 0.08
R1786:Zfp236 UTSW 18 82621304 missense probably benign 0.08
R2042:Zfp236 UTSW 18 82633109 missense probably damaging 1.00
R2132:Zfp236 UTSW 18 82621304 missense probably benign 0.08
R2133:Zfp236 UTSW 18 82621304 missense probably benign 0.08
R2247:Zfp236 UTSW 18 82604298 missense possibly damaging 0.82
R2484:Zfp236 UTSW 18 82668637 missense probably benign 0.05
R3715:Zfp236 UTSW 18 82632970 splice site probably benign
R4003:Zfp236 UTSW 18 82680745 nonsense probably null
R4031:Zfp236 UTSW 18 82624465 missense probably damaging 1.00
R4482:Zfp236 UTSW 18 82644221 missense probably benign 0.04
R4492:Zfp236 UTSW 18 82630000 missense probably damaging 1.00
R4561:Zfp236 UTSW 18 82620406 missense probably damaging 1.00
R4649:Zfp236 UTSW 18 82597659 missense probably damaging 1.00
R4902:Zfp236 UTSW 18 82609418 missense possibly damaging 0.89
R5064:Zfp236 UTSW 18 82691576 critical splice donor site probably null
R5084:Zfp236 UTSW 18 82609431 missense probably damaging 1.00
R5090:Zfp236 UTSW 18 82618881 missense probably benign 0.08
R5191:Zfp236 UTSW 18 82621423 missense probably damaging 1.00
R5264:Zfp236 UTSW 18 82630094 missense probably damaging 1.00
R5264:Zfp236 UTSW 18 82658073 missense probably damaging 0.99
R5339:Zfp236 UTSW 18 82624366 missense probably damaging 0.99
R5375:Zfp236 UTSW 18 82597688 missense possibly damaging 0.93
R5445:Zfp236 UTSW 18 82682156 missense probably benign 0.02
R5513:Zfp236 UTSW 18 82658022 missense probably damaging 0.97
R5527:Zfp236 UTSW 18 82658034 missense possibly damaging 0.51
R5628:Zfp236 UTSW 18 82657122 missense probably damaging 1.00
R5758:Zfp236 UTSW 18 82671709 missense probably damaging 1.00
R5890:Zfp236 UTSW 18 82640151 missense possibly damaging 0.87
R6137:Zfp236 UTSW 18 82671794 missense possibly damaging 0.89
R6193:Zfp236 UTSW 18 82604247 missense probably damaging 1.00
R6198:Zfp236 UTSW 18 82657153 missense probably damaging 1.00
R6239:Zfp236 UTSW 18 82657104 missense possibly damaging 0.53
R6705:Zfp236 UTSW 18 82633737 missense probably damaging 0.97
R6948:Zfp236 UTSW 18 82644062 missense possibly damaging 0.94
R6989:Zfp236 UTSW 18 82628363 missense probably damaging 1.00
R7002:Zfp236 UTSW 18 82691576 critical splice donor site probably null
R7113:Zfp236 UTSW 18 82620337 missense possibly damaging 0.82
R7261:Zfp236 UTSW 18 82609345 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TGATCTGCCAACTGCTGTCC -3'
(R):5'- AAGGCAGCAGGAGTTTCTTTAGG -3'

Sequencing Primer
(F):5'- AAGCGCTGCATCTTCTGTG -3'
(R):5'- AGTGCACGGTCTCTTTCA -3'
Posted On2015-07-21