Mutagenetix > Incidental Mutation

Incidental Mutation 'R4503:Cdk5'

331894

Institutional Source

Beutler Lab

Gene Symbol

Cdk5

Ensembl Gene

ENSMUSG00000028969

Gene Name

cyclin dependent kinase 5

Synonyms

Crk6

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.715) question?

Stock #

R4503 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24623239-24628528 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 24624617 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 258 (T258M)

Ref Sequence

ENSEMBL: ENSMUSP00000030814 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030814] [ENSMUST00000049346] [ENSMUST00000141966] [ENSMUST00000153274] [ENSMUST00000196296] [ENSMUST00000198990]

AlphaFold

P49615

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030814
AA Change: T258M

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000030814
Gene: ENSMUSG00000028969
AA Change: T258M

Domain	Start	End	E-Value	Type
S_TKc	4	286	6.11e-101	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000049346

SMART Domains

Protein: ENSMUSP00000039914
Gene: ENSMUSG00000038276

Domain	Start	End	E-Value	Type
Pfam:ASC	21	458	2.5e-89	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127315

Predicted Effect

probably benign
Transcript: ENSMUST00000141966

SMART Domains

Protein: ENSMUSP00000117215
Gene: ENSMUSG00000028962

Domain	Start	End	E-Value	Type
low complexity region	93	110	N/A	INTRINSIC
low complexity region	113	129	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153274

Predicted Effect

probably benign
Transcript: ENSMUST00000196296

SMART Domains

Protein: ENSMUSP00000143083
Gene: ENSMUSG00000038276

Domain	Start	End	E-Value	Type
Pfam:ASC	21	459	4e-155	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197210

Predicted Effect

possibly damaging
Transcript: ENSMUST00000198990
AA Change: T226M

PolyPhen 2 Score 0.557 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000142413
Gene: ENSMUSG00000028969
AA Change: T226M

Domain	Start	End	E-Value	Type
Pfam:Pkinase	4	101	9.7e-23	PFAM
Pfam:Pkinase_Tyr	4	102	2.7e-13	PFAM
Pfam:Pkinase	97	254	6.6e-30	PFAM
Pfam:Pkinase_Tyr	102	200	9.4e-6	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197619

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198241

Predicted Effect

probably benign
Transcript: ENSMUST00000198442

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a proline-directed serine/threonine kinase that is a member of the cyclin-dependent kinase family of proteins. Unlike other members of the family, the protein encoded by this gene does not directly control cell cycle regulation. Instead the protein, which is predominantly expressed at high levels in mammalian postmitotic central nervous system neurons, functions in diverse processes such as synaptic plasticity and neuronal migration through phosphorylation of proteins required for cytoskeletal organization, endocytosis and exocytosis, and apoptosis. In humans, an allelic variant of the gene that results in undetectable levels of the protein has been associated with lethal autosomal recessive lissencephaly-7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality and abnormalities of the cerebellum and nervous system. Mutant mice are cyanotic, hypoactive, exhibit shallow breathing, and fail to suckle. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam21	A	G	12: 81,607,672 (GRCm39)	L30P	probably benign	Het
Adamts20	T	C	15: 94,277,631 (GRCm39)	H277R	probably damaging	Het
Arl6ip1	AAAATAAATAAATAAATAAATAAATA	AAAATAAATAAATAAATAAATAAATAAATA	7: 117,721,122 (GRCm39)		probably benign	Het
Atp13a5	G	T	16: 29,112,346 (GRCm39)	N598K	probably benign	Het
Ccdc171	A	G	4: 83,782,560 (GRCm39)	E1284G	probably damaging	Het
Col3a1	T	C	1: 45,387,837 (GRCm39)		probably benign	Het
Coro6	A	G	11: 77,360,272 (GRCm39)	E414G	probably benign	Het
Dst	T	C	1: 34,301,334 (GRCm39)		probably null	Het
Fabp3	C	T	4: 130,206,245 (GRCm39)		probably null	Het
Gpr39	G	A	1: 125,605,728 (GRCm39)	V219I	probably benign	Het
H2bc18	A	T	3: 96,177,240 (GRCm39)	K58M	possibly damaging	Het
Kank4	G	A	4: 98,665,335 (GRCm39)	S653L	possibly damaging	Het
Mapkbp1	T	C	2: 119,846,187 (GRCm39)	I451T	probably damaging	Het
Ncf2	A	G	1: 152,709,529 (GRCm39)	E342G	probably benign	Het
Or5k15	T	C	16: 58,710,539 (GRCm39)	I15V	probably benign	Het
Or6aa1	T	A	7: 86,044,485 (GRCm39)	T74S	possibly damaging	Het
Pds5b	T	C	5: 150,652,399 (GRCm39)	L222P	probably damaging	Het
Rpl5	T	C	5: 108,052,723 (GRCm39)	F223S	possibly damaging	Het
Sacs	A	G	14: 61,445,052 (GRCm39)	N2366S	probably damaging	Het
Sall2	T	C	14: 52,550,916 (GRCm39)	M758V	probably benign	Het
Sh3tc2	A	G	18: 62,107,694 (GRCm39)	E235G	probably damaging	Het
Slc49a4	T	C	16: 35,539,787 (GRCm39)	M345V	probably benign	Het
Smad2	T	A	18: 76,435,663 (GRCm39)	S419T	probably benign	Het
Sprr3	T	C	3: 92,364,683 (GRCm39)	I54V	possibly damaging	Het
Tbck	A	G	3: 132,456,981 (GRCm39)	T632A	probably benign	Het
Tmem131	T	C	1: 36,864,560 (GRCm39)	T558A	probably benign	Het
Tmem178	C	T	17: 81,293,693 (GRCm39)	T162I	probably benign	Het
Zfp619	A	G	7: 39,186,280 (GRCm39)	H770R	probably damaging	Het
Zfp938	A	G	10: 82,062,105 (GRCm39)	S172P	possibly damaging	Het

Other mutations in Cdk5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01311:Cdk5	APN	5	24,624,593 (GRCm39)	splice site	probably null
IGL02147:Cdk5	APN	5	24,625,318 (GRCm39)	missense	probably benign	0.01
IGL02395:Cdk5	APN	5	24,624,635 (GRCm39)	missense	possibly damaging	0.79
IGL02557:Cdk5	APN	5	24,624,651 (GRCm39)	missense	probably benign	0.00
R5103:Cdk5	UTSW	5	24,627,833 (GRCm39)	missense	probably damaging	1.00
R5215:Cdk5	UTSW	5	24,624,459 (GRCm39)	missense	probably benign	0.24
R7972:Cdk5	UTSW	5	24,624,656 (GRCm39)	missense	probably benign
R8057:Cdk5	UTSW	5	24,625,782 (GRCm39)	missense	probably damaging	1.00
R8923:Cdk5	UTSW	5	24,625,284 (GRCm39)	missense	possibly damaging	0.86
R8968:Cdk5	UTSW	5	24,627,379 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTCAATAGGTTCTGCAGGGG -3'
(R):5'- ACATGGACACACTGCTAGGG -3'

Sequencing Primer
(F):5'- TTCTGCAGGGGGAAGAAAGGC -3'
(R):5'- CCAAGCTGCCAGACTATAAGGTG -3'

Posted On

2015-07-21