Incidental Mutation 'R4503:Smad2'
ID 331910
Institutional Source Beutler Lab
Gene Symbol Smad2
Ensembl Gene ENSMUSG00000024563
Gene Name SMAD family member 2
Synonyms Madr2, Madh2, Smad 2, 7120426M23Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4503 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 76374651-76444034 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 76435663 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 419 (S419T)
Ref Sequence ENSEMBL: ENSMUSP00000109563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025453] [ENSMUST00000091831] [ENSMUST00000113930] [ENSMUST00000165084] [ENSMUST00000168423] [ENSMUST00000171256] [ENSMUST00000172198]
AlphaFold Q62432
Predicted Effect probably benign
Transcript: ENSMUST00000025453
SMART Domains Protein: ENSMUSP00000025453
Gene: ENSMUSG00000024563

DomainStartEndE-ValueType
DWA 36 174 1e-64 SMART
Blast:DWB 230 261 2e-10 BLAST
DWB 272 443 2.25e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091831
SMART Domains Protein: ENSMUSP00000089439
Gene: ENSMUSG00000024563

DomainStartEndE-ValueType
DWA 36 144 1.68e-66 SMART
Blast:DWB 200 231 1e-10 BLAST
DWB 242 413 2.25e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113930
AA Change: S419T

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000109563
Gene: ENSMUSG00000024563
AA Change: S419T

DomainStartEndE-ValueType
DWA 36 144 1.68e-66 SMART
Blast:DWB 200 231 9e-11 BLAST
DWB 242 408 4.38e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165084
SMART Domains Protein: ENSMUSP00000132851
Gene: ENSMUSG00000024563

DomainStartEndE-ValueType
DWA 36 144 7.85e-67 SMART
PDB:1KHX|A 166 204 3e-19 PDB
SCOP:d1khxa_ 190 204 7e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168423
SMART Domains Protein: ENSMUSP00000130115
Gene: ENSMUSG00000024563

DomainStartEndE-ValueType
DWA 36 174 1e-64 SMART
Blast:DWB 230 261 2e-10 BLAST
DWB 272 443 2.25e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171256
SMART Domains Protein: ENSMUSP00000125883
Gene: ENSMUSG00000024563

DomainStartEndE-ValueType
DWA 36 174 1e-64 SMART
Blast:DWA 182 213 3e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172198
SMART Domains Protein: ENSMUSP00000129232
Gene: ENSMUSG00000024563

DomainStartEndE-ValueType
Pfam:MH2 28 58 1.8e-10 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signal of the transforming growth factor (TGF)-beta, and thus regulates multiple cellular processes, such as cell proliferation, apoptosis, and differentiation. This protein is recruited to the TGF-beta receptors through its interaction with the SMAD anchor for receptor activation (SARA) protein. In response to TGF-beta signal, this protein is phosphorylated by the TGF-beta receptors. The phosphorylation induces the dissociation of this protein with SARA and the association with the family member SMAD4. The association with SMAD4 is important for the translocation of this protein into the nucleus, where it binds to target promoters and forms a transcription repressor complex with other cofactors. This protein can also be phosphorylated by activin type 1 receptor kinase, and mediates the signal from the activin. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutant embryos die at day 6.5-8.5 with multiple defects, including failed gastrulation, lack of mesoderm, visceral endoderm dysfunction and failure to form anterior-posterior axis. Heterozygotes may show gastrulation defects and lack mandible or eyes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 A G 12: 81,607,672 (GRCm39) L30P probably benign Het
Adamts20 T C 15: 94,277,631 (GRCm39) H277R probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 117,721,122 (GRCm39) probably benign Het
Atp13a5 G T 16: 29,112,346 (GRCm39) N598K probably benign Het
Ccdc171 A G 4: 83,782,560 (GRCm39) E1284G probably damaging Het
Cdk5 G A 5: 24,624,617 (GRCm39) T258M possibly damaging Het
Col3a1 T C 1: 45,387,837 (GRCm39) probably benign Het
Coro6 A G 11: 77,360,272 (GRCm39) E414G probably benign Het
Dst T C 1: 34,301,334 (GRCm39) probably null Het
Fabp3 C T 4: 130,206,245 (GRCm39) probably null Het
Gpr39 G A 1: 125,605,728 (GRCm39) V219I probably benign Het
H2bc18 A T 3: 96,177,240 (GRCm39) K58M possibly damaging Het
Kank4 G A 4: 98,665,335 (GRCm39) S653L possibly damaging Het
Mapkbp1 T C 2: 119,846,187 (GRCm39) I451T probably damaging Het
Ncf2 A G 1: 152,709,529 (GRCm39) E342G probably benign Het
Or5k15 T C 16: 58,710,539 (GRCm39) I15V probably benign Het
Or6aa1 T A 7: 86,044,485 (GRCm39) T74S possibly damaging Het
Pds5b T C 5: 150,652,399 (GRCm39) L222P probably damaging Het
Rpl5 T C 5: 108,052,723 (GRCm39) F223S possibly damaging Het
Sacs A G 14: 61,445,052 (GRCm39) N2366S probably damaging Het
Sall2 T C 14: 52,550,916 (GRCm39) M758V probably benign Het
Sh3tc2 A G 18: 62,107,694 (GRCm39) E235G probably damaging Het
Slc49a4 T C 16: 35,539,787 (GRCm39) M345V probably benign Het
Sprr3 T C 3: 92,364,683 (GRCm39) I54V possibly damaging Het
Tbck A G 3: 132,456,981 (GRCm39) T632A probably benign Het
Tmem131 T C 1: 36,864,560 (GRCm39) T558A probably benign Het
Tmem178 C T 17: 81,293,693 (GRCm39) T162I probably benign Het
Zfp619 A G 7: 39,186,280 (GRCm39) H770R probably damaging Het
Zfp938 A G 10: 82,062,105 (GRCm39) S172P possibly damaging Het
Other mutations in Smad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Smad2 APN 18 76,431,566 (GRCm39) missense possibly damaging 0.94
IGL00978:Smad2 APN 18 76,432,846 (GRCm39) splice site probably benign
IGL01295:Smad2 APN 18 76,435,501 (GRCm39) missense probably benign 0.05
IGL01887:Smad2 APN 18 76,432,965 (GRCm39) missense probably damaging 1.00
IGL01960:Smad2 APN 18 76,395,555 (GRCm39) intron probably benign
IGL02881:Smad2 APN 18 76,432,851 (GRCm39) splice site probably null
IGL02977:Smad2 APN 18 76,422,235 (GRCm39) missense possibly damaging 0.64
R0333:Smad2 UTSW 18 76,395,692 (GRCm39) missense probably damaging 1.00
R0391:Smad2 UTSW 18 76,422,108 (GRCm39) critical splice acceptor site probably null
R0523:Smad2 UTSW 18 76,395,623 (GRCm39) missense probably benign
R0570:Smad2 UTSW 18 76,422,250 (GRCm39) splice site probably benign
R0624:Smad2 UTSW 18 76,433,064 (GRCm39) missense probably damaging 1.00
R1573:Smad2 UTSW 18 76,395,657 (GRCm39) missense possibly damaging 0.89
R1953:Smad2 UTSW 18 76,395,776 (GRCm39) missense possibly damaging 0.90
R2132:Smad2 UTSW 18 76,421,155 (GRCm39) nonsense probably null
R2213:Smad2 UTSW 18 76,437,697 (GRCm39) missense probably damaging 1.00
R3021:Smad2 UTSW 18 76,395,703 (GRCm39) missense probably damaging 1.00
R3917:Smad2 UTSW 18 76,421,008 (GRCm39) missense probably benign 0.42
R5253:Smad2 UTSW 18 76,421,124 (GRCm39) missense probably damaging 1.00
R5290:Smad2 UTSW 18 76,395,795 (GRCm39) missense probably damaging 1.00
R5891:Smad2 UTSW 18 76,433,046 (GRCm39) missense probably damaging 1.00
R6294:Smad2 UTSW 18 76,422,233 (GRCm39) missense probably benign 0.31
R6879:Smad2 UTSW 18 76,395,725 (GRCm39) missense possibly damaging 0.49
R7430:Smad2 UTSW 18 76,421,151 (GRCm39) missense probably damaging 1.00
R7503:Smad2 UTSW 18 76,419,956 (GRCm39) missense probably benign
R7757:Smad2 UTSW 18 76,421,084 (GRCm39) missense probably benign 0.40
R8072:Smad2 UTSW 18 76,420,022 (GRCm39) critical splice donor site probably null
R9132:Smad2 UTSW 18 76,395,573 (GRCm39) missense possibly damaging 0.87
R9159:Smad2 UTSW 18 76,395,573 (GRCm39) missense possibly damaging 0.87
R9184:Smad2 UTSW 18 76,422,171 (GRCm39) missense probably benign 0.00
Z1177:Smad2 UTSW 18 76,421,074 (GRCm39) missense probably damaging 1.00
Z1177:Smad2 UTSW 18 76,421,073 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGCTCAGTCTGTCAACC -3'
(R):5'- ACCTCTGGTTTCATAAAGTGCC -3'

Sequencing Primer
(F):5'- CTGTCAACCAGGGTTTTGAAGC -3'
(R):5'- ATTCATGCATGGCCATGAACTC -3'
Posted On 2015-07-21