Incidental Mutation 'R4504:Fbxo18'
ID331913
Institutional Source Beutler Lab
Gene Symbol Fbxo18
Ensembl Gene ENSMUSG00000058594
Gene NameF-box protein 18
SynonymsFbx18
MMRRC Submission 041755-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.258) question?
Stock #R4504 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location11742573-11777582 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11749017 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 838 (V838A)
Ref Sequence ENSEMBL: ENSMUSP00000071495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071564] [ENSMUST00000131893]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071564
AA Change: V838A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071495
Gene: ENSMUSG00000058594
AA Change: V838A

DomainStartEndE-ValueType
FBOX 213 256 3.94e-3 SMART
Pfam:UvrD-helicase 626 692 8e-10 PFAM
Pfam:UvrD_C 862 935 1.7e-12 PFAM
Pfam:UvrD_C_2 867 931 1.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123723
Predicted Effect possibly damaging
Transcript: ENSMUST00000131893
AA Change: V253A

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116392
Gene: ENSMUSG00000058594
AA Change: V253A

DomainStartEndE-ValueType
SCOP:d1pjr_1 63 141 5e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155604
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbx class. It contains an F-box motif and seven conserved helicase motifs, and has both DNA-dependent ATPase and DNA unwinding activities. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503E14Rik A G 14: 44,170,442 S45P probably damaging Het
Adgrg4 C T X: 56,916,442 R1124C possibly damaging Het
Anxa13 T C 15: 58,356,203 noncoding transcript Het
Arhgap32 C A 9: 32,181,839 probably null Het
Carm1 T C 9: 21,569,526 F99L probably damaging Het
Dennd1b A G 1: 139,085,927 E253G possibly damaging Het
Dsg4 A G 18: 20,461,436 I541V probably benign Het
Dstyk A G 1: 132,434,389 T186A possibly damaging Het
Ear1 A T 14: 43,819,264 V49D probably benign Het
Epha10 A G 4: 124,915,687 probably benign Het
Fndc8 T A 11: 82,892,400 M69K probably benign Het
Gm13023 G C 4: 143,793,983 E102Q probably benign Het
Golga1 T C 2: 39,023,454 I482V probably benign Het
Hivep3 G A 4: 119,733,793 probably benign Het
Igkv13-85 A G 6: 68,930,372 F82L probably damaging Het
Itih1 G A 14: 30,935,885 R410C probably damaging Het
Kcnc2 T C 10: 112,455,794 W296R probably damaging Het
Kcnq3 A T 15: 65,995,342 Y817* probably null Het
Kif3b T C 2: 153,323,644 probably null Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Lhx5 C A 5: 120,440,008 H298N possibly damaging Het
Notch1 A G 2: 26,472,177 V1022A probably benign Het
Npc1l1 A G 11: 6,228,741 L223S possibly damaging Het
Olfr1258 C T 2: 89,930,351 P181S possibly damaging Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr279 T C 15: 98,498,134 F221L probably benign Het
Pbxip1 A G 3: 89,446,383 D281G possibly damaging Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Pcsk5 C T 19: 17,451,955 C1553Y probably damaging Het
Pdgfc A C 3: 81,174,991 M164L probably benign Het
Pdzd8 T C 19: 59,345,448 Y47C probably damaging Het
Pip5k1c T A 10: 81,315,111 I633N probably damaging Het
Pkn1 G A 8: 83,692,927 R16* probably null Het
Pole2 A G 12: 69,222,468 V85A probably benign Het
Ppp4c A C 7: 126,787,465 L150R probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Rnf144a T A 12: 26,327,303 R92S probably benign Het
Sbno2 C A 10: 80,060,492 R898L possibly damaging Het
Scnn1b A C 7: 121,912,475 N370T probably damaging Het
Taar3 A G 10: 23,949,573 I6V possibly damaging Het
Vps13a T C 19: 16,695,502 E1302G possibly damaging Het
Other mutations in Fbxo18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Fbxo18 APN 2 11757523 nonsense probably null
IGL02081:Fbxo18 APN 2 11764127 missense probably benign 0.31
IGL02082:Fbxo18 APN 2 11764127 missense probably benign 0.31
IGL02084:Fbxo18 APN 2 11764127 missense probably benign 0.31
IGL02086:Fbxo18 APN 2 11764127 missense probably benign 0.31
IGL02369:Fbxo18 APN 2 11747158 missense possibly damaging 0.61
IGL02584:Fbxo18 APN 2 11759958 missense probably benign 0.07
IGL03138:Fbxo18 UTSW 2 11749509 intron probably benign
R0384:Fbxo18 UTSW 2 11749578 missense probably damaging 1.00
R0479:Fbxo18 UTSW 2 11758419 missense probably damaging 1.00
R0972:Fbxo18 UTSW 2 11764088 splice site probably benign
R1420:Fbxo18 UTSW 2 11767682 missense probably benign 0.01
R1827:Fbxo18 UTSW 2 11763888 missense possibly damaging 0.88
R1832:Fbxo18 UTSW 2 11767400 missense probably benign 0.08
R1960:Fbxo18 UTSW 2 11757528 missense probably damaging 0.98
R2040:Fbxo18 UTSW 2 11769895 missense possibly damaging 0.66
R2044:Fbxo18 UTSW 2 11762970 missense possibly damaging 0.89
R2102:Fbxo18 UTSW 2 11758289 missense probably benign 0.18
R3236:Fbxo18 UTSW 2 11769826 missense probably damaging 1.00
R3975:Fbxo18 UTSW 2 11767210 missense possibly damaging 0.72
R4505:Fbxo18 UTSW 2 11749017 missense possibly damaging 0.91
R4507:Fbxo18 UTSW 2 11749017 missense possibly damaging 0.91
R4799:Fbxo18 UTSW 2 11755747 missense probably damaging 1.00
R4894:Fbxo18 UTSW 2 11762960 missense probably damaging 1.00
R4994:Fbxo18 UTSW 2 11764230 missense probably damaging 1.00
R5579:Fbxo18 UTSW 2 11748993 missense probably damaging 0.97
R5801:Fbxo18 UTSW 2 11769826 missense probably damaging 1.00
R6255:Fbxo18 UTSW 2 11748446 missense probably benign 0.31
R7011:Fbxo18 UTSW 2 11762963 missense probably damaging 1.00
R7177:Fbxo18 UTSW 2 11755711 missense probably damaging 1.00
R7243:Fbxo18 UTSW 2 11751525 missense probably benign 0.11
R7331:Fbxo18 UTSW 2 11763986 missense probably benign
R7361:Fbxo18 UTSW 2 11747076 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGGGAAAAGAACTGCTCC -3'
(R):5'- CTGAACTGACTTGATCATGGACAC -3'

Sequencing Primer
(F):5'- ATACTCTTAGAGCACAGCTTCTGG -3'
(R):5'- CTGACTTGATCATGGACACACAGTG -3'
Posted On2015-07-21