Incidental Mutation 'R4506:Vmn2r23'
ID332012
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Namevomeronasal 2, receptor 23
SynonymsEG435916
MMRRC Submission 041584-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4506 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location123702821-123742291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123702925 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 35 (Q35H)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
Predicted Effect probably damaging
Transcript: ENSMUST00000172391
AA Change: Q35H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: Q35H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Meta Mutation Damage Score 0.0288 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,261 P137T probably damaging Het
Abcc5 A T 16: 20,333,695 I1367N probably damaging Het
Ace T A 11: 105,976,666 L152Q probably damaging Het
Adam19 G A 11: 46,118,444 D232N possibly damaging Het
Anapc4 A T 5: 52,835,730 N61I possibly damaging Het
Ap5m1 T C 14: 49,073,761 V96A probably damaging Het
Atr T A 9: 95,865,237 C191S probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cnot6l A T 5: 96,086,174 V326E possibly damaging Het
Fcer2a A T 8: 3,688,603 probably null Het
Fgfr3 A G 5: 33,729,999 T221A probably damaging Het
Gm6632 C T 5: 59,054,478 noncoding transcript Het
Gm8909 A T 17: 36,161,480 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ip6k3 A T 17: 27,145,180 L298Q possibly damaging Het
Itpr1 A G 6: 108,432,686 D1727G probably damaging Het
Kdm2b T C 5: 122,888,625 T589A possibly damaging Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Map3k13 A G 16: 21,922,178 S752G probably benign Het
Mvb12a G T 8: 71,543,459 A86S probably benign Het
Nktr T A 9: 121,748,883 probably benign Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr393 A T 11: 73,847,695 C143* probably null Het
Parp4 T A 14: 56,652,304 N1847K unknown Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc7a5 A T 8: 121,887,495 probably null Het
Slc7a9 A T 7: 35,453,420 T88S probably damaging Het
Tbrg1 T A 9: 37,654,395 E87V probably damaging Het
Tnfsf4 T C 1: 161,417,174 S145P probably damaging Het
Tomm34 C A 2: 164,054,372 probably null Het
Trpv3 A G 11: 73,295,324 N647S probably benign Het
Upf1 G A 8: 70,337,566 R637C probably damaging Het
Wdtc1 C T 4: 133,308,819 V137M probably damaging Het
Zfp276 G A 8: 123,264,927 probably null Het
Zfp90 C T 8: 106,424,864 P403L possibly damaging Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123729725 missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123729596 missense probably benign
IGL01073:Vmn2r23 APN 6 123712800 missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123704424 missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123704407 missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123741886 missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123741860 missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123741744 missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123741836 missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123704478 missense probably benign
IGL02831:Vmn2r23 APN 6 123704385 missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123704396 missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123741619 missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123741782 missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123704374 missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123729626 missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123729721 missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123742135 missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123742004 missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123713270 nonsense probably null
R1629:Vmn2r23 UTSW 6 123713427 missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123729690 missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123702915 missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123713010 missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123741499 missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123704425 missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123742188 nonsense probably null
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123713170 missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123741389 missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123729738 missense probably benign
R4652:Vmn2r23 UTSW 6 123741730 missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123741826 missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123733349 missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123713002 missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123733273 missense probably benign
R5761:Vmn2r23 UTSW 6 123712759 missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123733393 missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123712942 missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123741895 missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123704400 missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123712902 missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123713425 missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123733273 missense probably benign
R6925:Vmn2r23 UTSW 6 123704553 missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123713022 missense probably benign
R7215:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123741581 missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123704579 missense probably benign 0.01
T0975:Vmn2r23 UTSW 6 123713161 missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123742108 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTTGACCCACATGGACCAG -3'
(R):5'- CTCCATGAAGTTGAAGACAGGAGAC -3'

Sequencing Primer
(F):5'- GGACCAGAAAGGCACATGTTTTATC -3'
(R):5'- CAGTAGAGCTGGGAGAGATCAAC -3'
Posted On2015-07-21