Incidental Mutation 'R4507:Tec'
ID332046
Institutional Source Beutler Lab
Gene Symbol Tec
Ensembl Gene ENSMUSG00000029217
Gene Nametec protein tyrosine kinase
Synonyms
MMRRC Submission 041756-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R4507 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location72755716-72868483 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72760358 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 506 (D506G)
Ref Sequence ENSEMBL: ENSMUSP00000109224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071944] [ENSMUST00000073843] [ENSMUST00000113594] [ENSMUST00000126481] [ENSMUST00000138842]
Predicted Effect probably damaging
Transcript: ENSMUST00000071944
AA Change: D506G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071836
Gene: ENSMUSG00000029217
AA Change: D506G

DomainStartEndE-ValueType
PH 5 113 2.13e-17 SMART
BTK 113 149 1.79e-21 SMART
low complexity region 158 177 N/A INTRINSIC
SH3 181 237 7.06e-17 SMART
SH2 244 335 4.05e-28 SMART
TyrKc 369 618 2.13e-132 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000073843
AA Change: D484G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073509
Gene: ENSMUSG00000029217
AA Change: D484G

DomainStartEndE-ValueType
PH 5 113 2.13e-17 SMART
BTK 113 149 1.79e-21 SMART
low complexity region 158 177 N/A INTRINSIC
SH3 181 230 2.85e-3 SMART
SH2 222 313 9.96e-28 SMART
TyrKc 347 596 2.13e-132 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113594
AA Change: D506G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109224
Gene: ENSMUSG00000029217
AA Change: D506G

DomainStartEndE-ValueType
PH 5 113 2.13e-17 SMART
BTK 113 149 1.79e-21 SMART
low complexity region 158 177 N/A INTRINSIC
SH3 181 237 7.06e-17 SMART
SH2 244 335 4.05e-28 SMART
TyrKc 369 618 2.13e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126481
SMART Domains Protein: ENSMUSP00000123606
Gene: ENSMUSG00000029217

DomainStartEndE-ValueType
PH 5 113 2.13e-17 SMART
BTK 113 149 1.79e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138842
SMART Domains Protein: ENSMUSP00000120155
Gene: ENSMUSG00000029217

DomainStartEndE-ValueType
Pfam:PH 5 98 1.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155342
SMART Domains Protein: ENSMUSP00000118980
Gene: ENSMUSG00000029217

DomainStartEndE-ValueType
BTK 2 33 8.62e-15 SMART
Meta Mutation Damage Score 0.59 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Tec family of non-receptor protein-tyrosine kinases containing a pleckstrin homology domain. Tec family kinases are involved in the intracellular signaling mechanisms of cytokine receptors, lymphocyte surface antigens, heterotrimeric G-protein coupled receptors, and integrin molecules. They are also key players in the regulation of the immune functions. Tec kinase is an integral component of T cell signaling and has a distinct role in T cell activation. This gene may be associated with myelodysplastic syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a minor reduction in platetet aggregation in response to threshold concentrations of collagen-related peptide or collagen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 131,145,872 Y83C probably damaging Het
Abca8a A T 11: 110,063,025 I863N probably benign Het
Abr A G 11: 76,451,857 I608T possibly damaging Het
Aebp1 A G 11: 5,870,565 Y485C probably damaging Het
Akap5 A G 12: 76,327,907 K38E possibly damaging Het
Bhlhe22 T C 3: 18,054,959 S58P probably benign Het
Bmp3 A T 5: 98,879,774 I418L probably damaging Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Catsperb T A 12: 101,480,828 probably null Het
Clasrp C A 7: 19,585,240 probably benign Het
Clic1 A G 17: 35,052,785 T52A probably benign Het
Dnah7c C T 1: 46,766,611 R3407C probably damaging Het
Elp2 A G 18: 24,626,120 probably null Het
Epha10 A G 4: 124,915,687 probably benign Het
Fbxo18 A G 2: 11,749,017 V838A possibly damaging Het
Folh1 T C 7: 86,757,008 T286A probably benign Het
Gm8909 A T 17: 36,161,480 probably benign Het
Hcn2 T A 10: 79,724,786 I317N probably damaging Het
Hectd1 A T 12: 51,790,493 L760I probably damaging Het
Hoxc10 A T 15: 102,966,952 Y32F probably damaging Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Lhx5 C A 5: 120,440,008 H298N possibly damaging Het
Mdh1 C T 11: 21,558,470 V291M probably benign Het
Myh14 T C 7: 44,629,991 T963A probably benign Het
Mylk T C 16: 34,953,695 F1305L probably benign Het
Olfr1258 C T 2: 89,930,351 P181S possibly damaging Het
Olfr877 T C 9: 37,854,905 F29S possibly damaging Het
Parp11 A G 6: 127,474,283 R99G probably damaging Het
Phactr1 C A 13: 43,096,794 T522N probably damaging Het
Ptprs T C 17: 56,419,014 T1423A probably damaging Het
Ralgapa2 T C 2: 146,353,248 I1253V probably benign Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Samd4b A G 7: 28,407,500 M329T probably benign Het
Srrm4 T C 5: 116,446,553 Y486C probably damaging Het
Taar3 A G 10: 23,949,573 I6V possibly damaging Het
Trabd A G 15: 89,085,630 I316V probably damaging Het
Ubr5 A T 15: 38,013,542 F952I probably damaging Het
Vat1l T C 8: 114,205,816 L34P probably benign Het
Other mutations in Tec
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Tec APN 5 72768768 missense probably damaging 1.00
IGL00980:Tec APN 5 72786798 missense probably damaging 1.00
IGL01986:Tec APN 5 72782005 nonsense probably null
IGL02505:Tec APN 5 72789244 missense probably damaging 1.00
IGL02522:Tec APN 5 72789172 missense probably benign 0.01
IGL02527:Tec APN 5 72779415 splice site probably null
IGL03292:Tec APN 5 72757364 missense probably null 0.98
IGL02988:Tec UTSW 5 72768747 missense possibly damaging 0.95
R0254:Tec UTSW 5 72763556 splice site probably benign
R0254:Tec UTSW 5 72783738 missense probably benign 0.12
R0646:Tec UTSW 5 72823497 missense probably damaging 1.00
R1122:Tec UTSW 5 72779449 missense probably damaging 0.96
R1495:Tec UTSW 5 72786755 missense probably damaging 1.00
R1617:Tec UTSW 5 72782105 missense probably damaging 0.97
R3905:Tec UTSW 5 72760362 missense probably damaging 1.00
R3953:Tec UTSW 5 72782177 critical splice acceptor site probably null
R3954:Tec UTSW 5 72782177 critical splice acceptor site probably null
R3955:Tec UTSW 5 72782177 critical splice acceptor site probably null
R3981:Tec UTSW 5 72823599 utr 5 prime probably benign
R4061:Tec UTSW 5 72823409 unclassified probably benign
R4389:Tec UTSW 5 72782007 missense probably benign
R4689:Tec UTSW 5 72823637 start gained probably benign
R4702:Tec UTSW 5 72783731 missense possibly damaging 0.71
R4776:Tec UTSW 5 72768776 missense probably benign 0.38
R4911:Tec UTSW 5 72756351 missense probably benign 0.05
R4923:Tec UTSW 5 72782022 nonsense probably null
R4932:Tec UTSW 5 72760393 nonsense probably null
R5595:Tec UTSW 5 72768744 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GCCCGAGGCCTGAGTTTT -3'
(R):5'- GAGGTACCTTCAGTATGGCTG -3'

Sequencing Primer
(F):5'- TTTTCTAGCCAGAGAGCCTCAGAG -3'
(R):5'- GAGGTACCTTCAGTATGGCTGTAAAC -3'
Posted On2015-07-21