Incidental Mutation 'R4507:Taar3'
ID332059
Institutional Source Beutler Lab
Gene Symbol Taar3
Ensembl Gene ENSMUSG00000069708
Gene Nametrace amine-associated receptor 3
Synonyms
MMRRC Submission 041756-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R4507 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location23949558-23950589 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23949573 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 6 (I6V)
Ref Sequence ENSEMBL: ENSMUSP00000036817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045152]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045152
AA Change: I6V

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036817
Gene: ENSMUSG00000069708
AA Change: I6V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 42 320 1.8e-13 PFAM
Pfam:7tm_1 48 309 1.4e-53 PFAM
Meta Mutation Damage Score 0.0916 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 131,145,872 Y83C probably damaging Het
Abca8a A T 11: 110,063,025 I863N probably benign Het
Abr A G 11: 76,451,857 I608T possibly damaging Het
Aebp1 A G 11: 5,870,565 Y485C probably damaging Het
Akap5 A G 12: 76,327,907 K38E possibly damaging Het
Bhlhe22 T C 3: 18,054,959 S58P probably benign Het
Bmp3 A T 5: 98,879,774 I418L probably damaging Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Catsperb T A 12: 101,480,828 probably null Het
Clasrp C A 7: 19,585,240 probably benign Het
Clic1 A G 17: 35,052,785 T52A probably benign Het
Dnah7c C T 1: 46,766,611 R3407C probably damaging Het
Elp2 A G 18: 24,626,120 probably null Het
Epha10 A G 4: 124,915,687 probably benign Het
Fbxo18 A G 2: 11,749,017 V838A possibly damaging Het
Folh1 T C 7: 86,757,008 T286A probably benign Het
Gm8909 A T 17: 36,161,480 probably benign Het
Hcn2 T A 10: 79,724,786 I317N probably damaging Het
Hectd1 A T 12: 51,790,493 L760I probably damaging Het
Hoxc10 A T 15: 102,966,952 Y32F probably damaging Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Lhx5 C A 5: 120,440,008 H298N possibly damaging Het
Mdh1 C T 11: 21,558,470 V291M probably benign Het
Myh14 T C 7: 44,629,991 T963A probably benign Het
Mylk T C 16: 34,953,695 F1305L probably benign Het
Olfr1258 C T 2: 89,930,351 P181S possibly damaging Het
Olfr877 T C 9: 37,854,905 F29S possibly damaging Het
Parp11 A G 6: 127,474,283 R99G probably damaging Het
Phactr1 C A 13: 43,096,794 T522N probably damaging Het
Ptprs T C 17: 56,419,014 T1423A probably damaging Het
Ralgapa2 T C 2: 146,353,248 I1253V probably benign Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Samd4b A G 7: 28,407,500 M329T probably benign Het
Srrm4 T C 5: 116,446,553 Y486C probably damaging Het
Tec T C 5: 72,760,358 D506G probably damaging Het
Trabd A G 15: 89,085,630 I316V probably damaging Het
Ubr5 A T 15: 38,013,542 F952I probably damaging Het
Vat1l T C 8: 114,205,816 L34P probably benign Het
Other mutations in Taar3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Taar3 APN 10 23950432 missense probably damaging 1.00
IGL01777:Taar3 APN 10 23950005 missense probably benign 0.39
IGL01940:Taar3 APN 10 23949957 missense probably damaging 1.00
IGL02120:Taar3 APN 10 23950167 missense probably benign 0.33
PIT4445001:Taar3 UTSW 10 23949688 missense possibly damaging 0.85
R0582:Taar3 UTSW 10 23949817 missense probably damaging 1.00
R1925:Taar3 UTSW 10 23950585 missense probably benign 0.22
R2261:Taar3 UTSW 10 23950155 missense probably benign 0.00
R4088:Taar3 UTSW 10 23949859 missense possibly damaging 0.46
R4504:Taar3 UTSW 10 23949573 missense possibly damaging 0.84
R4505:Taar3 UTSW 10 23949573 missense possibly damaging 0.84
R4925:Taar3 UTSW 10 23950543 missense probably damaging 0.99
R6221:Taar3 UTSW 10 23950072 missense possibly damaging 0.92
R6451:Taar3 UTSW 10 23949807 missense possibly damaging 0.96
X0057:Taar3 UTSW 10 23949646 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGGCAATCTTCCAGTTCACTAC -3'
(R):5'- TGGTTGCCATGGAGAGGATC -3'

Sequencing Primer
(F):5'- GGAAGATCAGCCAGTGTTCTTAACC -3'
(R):5'- TGCCATGGAGAGGATCAGAAAGTTG -3'
Posted On2015-07-21