Incidental Mutation 'R2899:Vmn2r-ps159'
ID332083
Institutional Source Beutler Lab
Gene Symbol Vmn2r-ps159
Ensembl Gene ENSMUSG00000057021
Gene Namevomeronasal 2, receptor, pseudogene 159
SynonymsV2r8, Vmn2r-ps160, V2r9
MMRRC Submission 040487-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.825) question?
Stock #R2899 (G1)
Quality Score31
Status Validated
Chromosome4
Chromosomal Location156331103-156339499 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) G to T at 156334397 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000074107
SMART Domains Protein: ENSMUSP00000128975
Gene: ENSMUSG00000057021

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 423 1.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000096792
SMART Domains Protein: ENSMUSP00000094554
Gene: ENSMUSG00000057021

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 441 3.7e-31 PFAM
Pfam:NCD3G 510 563 1.4e-20 PFAM
Pfam:7tm_3 596 831 1.9e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189559
Meta Mutation Damage Score 0.0648 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,682 K211E probably benign Het
4930430A15Rik C A 2: 111,220,670 probably benign Het
Amigo3 T C 9: 108,054,154 S259P probably benign Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cd200r4 T C 16: 44,833,365 I175T probably damaging Het
Cep131 T C 11: 120,072,028 D425G probably benign Het
Clmp T C 9: 40,782,392 S302P probably damaging Het
Dusp6 T C 10: 99,263,845 S52P probably damaging Het
Epha5 T A 5: 84,233,808 I395F probably damaging Het
F5 A G 1: 164,186,900 E580G possibly damaging Het
Fbxo3 T A 2: 104,051,135 Y271N probably damaging Het
Fuca1 G A 4: 135,923,012 W131* probably null Het
Gdf7 C T 12: 8,298,470 A276T unknown Het
Limk1 A T 5: 134,688,300 probably null Het
Lrrc37a G A 11: 103,497,864 T2245I unknown Het
Neb A G 2: 52,185,323 I210T probably benign Het
Nf1 T G 11: 79,412,758 N420K possibly damaging Het
Olfr1453 T A 19: 13,027,694 I212F probably damaging Het
Pask G T 1: 93,334,547 T197K probably damaging Het
Pou4f3 T C 18: 42,395,523 L177P probably benign Het
Rassf1 G A 9: 107,554,194 G107R probably null Het
Rdx T C 9: 52,068,911 probably benign Het
Saraf T C 8: 34,161,231 L77P probably damaging Het
Syngap1 A G 17: 26,959,985 E483G probably damaging Het
Tsku T C 7: 98,352,917 N69S probably damaging Het
Usp36 G A 11: 118,276,756 probably benign Het
Zc3h6 T C 2: 129,002,232 V232A probably benign Het
Zfp143 T A 7: 110,072,129 S99R probably damaging Het
Zkscan3 A T 13: 21,393,973 L219Q probably damaging Het
Other mutations in Vmn2r-ps159
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Vmn2r-ps159 APN 4 156334196 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156338435 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156338460 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156334263 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156334397 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156334562 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156338484 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156338146 splice site noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156338435 exon noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156334263 exon noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156335590 intron noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156334605 exon noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156338146 splice site noncoding transcript
IGL01829:Vmn2r-ps159 APN 4 156333319 intron noncoding transcript
IGL01863:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01864:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01865:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01866:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01868:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01869:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01872:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01873:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01876:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01877:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01878:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01879:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01880:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01884:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01885:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01886:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01887:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01888:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01890:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01891:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01893:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01894:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01896:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01897:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01898:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01899:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01901:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01902:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01903:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01904:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01905:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01906:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01907:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01908:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01909:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01913:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01915:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01916:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01917:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01918:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01919:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01920:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01921:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01922:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01923:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01927:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01928:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01929:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01930:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01931:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01932:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01935:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01937:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01939:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01941:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01942:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01944:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01945:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01946:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01949:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01953:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01954:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01956:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01957:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL02270:Vmn2r-ps159 APN 4 156334655 exon noncoding transcript
R1746:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R1870:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R2147:Vmn2r-ps159 UTSW 4 156334719 critical splice donor site noncoding transcript
R2168:Vmn2r-ps159 UTSW 4 156338378 exon noncoding transcript
R2345:Vmn2r-ps159 UTSW 4 156337039 splice site noncoding transcript
R2510:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3106:Vmn2r-ps159 UTSW 4 156333435 intron noncoding transcript
R3122:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3405:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3430:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3732:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3751:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R4108:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R4112:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R4120:Vmn2r-ps159 UTSW 4 156334483 exon noncoding transcript
R4135:Vmn2r-ps159 UTSW 4 156338790 exon noncoding transcript
R4302:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R4475:Vmn2r-ps159 UTSW 4 156338790 exon noncoding transcript
R4840:Vmn2r-ps159 UTSW 4 156333438 intron noncoding transcript
R4872:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R5144:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R5271:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R5625:Vmn2r-ps159 UTSW 4 156334210 exon noncoding transcript
R5775:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- ATGACATCTTCAGCAAAGGTTG -3'
(R):5'- AACTGTAACCTTCATCACTCATCG -3'

Sequencing Primer
(F):5'- GACATCTTCAGCAAAGGTTGTTATC -3'
(R):5'- CGCCATATCATAGTTGTGCAG -3'
Posted On2015-07-27