Incidental Mutation 'R0105:Il15ra'
ID33235
Institutional Source Beutler Lab
Gene Symbol Il15ra
Ensembl Gene ENSMUSG00000023206
Gene Nameinterleukin 15 receptor, alpha chain
Synonyms
MMRRC Submission 038391-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R0105 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location11705290-11734317 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 11730648 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078834] [ENSMUST00000078834] [ENSMUST00000114831] [ENSMUST00000114831] [ENSMUST00000114832] [ENSMUST00000114832] [ENSMUST00000114833] [ENSMUST00000114833] [ENSMUST00000114834] [ENSMUST00000114834] [ENSMUST00000123600] [ENSMUST00000123600] [ENSMUST00000128156] [ENSMUST00000135341] [ENSMUST00000135341] [ENSMUST00000138349] [ENSMUST00000148748] [ENSMUST00000148748]
Predicted Effect probably null
Transcript: ENSMUST00000078834
SMART Domains Protein: ENSMUSP00000077878
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
low complexity region 107 117 N/A INTRINSIC
low complexity region 118 135 N/A INTRINSIC
low complexity region 154 172 N/A INTRINSIC
transmembrane domain 206 228 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000078834
SMART Domains Protein: ENSMUSP00000077878
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
low complexity region 107 117 N/A INTRINSIC
low complexity region 118 135 N/A INTRINSIC
low complexity region 154 172 N/A INTRINSIC
transmembrane domain 206 228 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000091456
Predicted Effect probably null
Transcript: ENSMUST00000114831
SMART Domains Protein: ENSMUSP00000110480
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
low complexity region 107 117 N/A INTRINSIC
transmembrane domain 173 195 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114831
SMART Domains Protein: ENSMUSP00000110480
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
low complexity region 107 117 N/A INTRINSIC
transmembrane domain 173 195 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114832
SMART Domains Protein: ENSMUSP00000110481
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
transmembrane domain 98 120 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114832
SMART Domains Protein: ENSMUSP00000110481
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
transmembrane domain 98 120 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114833
SMART Domains Protein: ENSMUSP00000110482
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
transmembrane domain 109 131 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114833
SMART Domains Protein: ENSMUSP00000110482
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
transmembrane domain 109 131 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114834
SMART Domains Protein: ENSMUSP00000110483
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
low complexity region 107 117 N/A INTRINSIC
transmembrane domain 140 162 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114834
SMART Domains Protein: ENSMUSP00000110483
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
low complexity region 107 117 N/A INTRINSIC
transmembrane domain 140 162 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000123600
SMART Domains Protein: ENSMUSP00000130792
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000123600
SMART Domains Protein: ENSMUSP00000130792
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126394
SMART Domains Protein: ENSMUSP00000131640
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000128156
SMART Domains Protein: ENSMUSP00000126364
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135341
SMART Domains Protein: ENSMUSP00000132731
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135341
SMART Domains Protein: ENSMUSP00000132731
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000138349
SMART Domains Protein: ENSMUSP00000131473
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139774
Predicted Effect probably null
Transcript: ENSMUST00000148748
SMART Domains Protein: ENSMUSP00000132058
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000148748
SMART Domains Protein: ENSMUSP00000132058
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191662
Meta Mutation Damage Score 0.526 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytokine receptor that specifically binds interleukin 15 (IL15) with high affinity. The receptors of IL15 and IL2 share two subunits, IL2R beta and IL2R gamma. This forms the basis of many overlapping biological activities of IL15 and IL2. The protein encoded by this gene is structurally related to IL2R alpha, an additional IL2-specific alpha subunit necessary for high affinity IL2 binding. Unlike IL2RA, IL15RA is capable of binding IL15 with high affinity independent of other subunits, which suggests distinct roles between IL15 and IL2. This receptor is reported to enhance cell proliferation and expression of apoptosis inhibitor BCL2L1/BCL2-XL and BCL2. Multiple alternatively spliced transcript variants of this gene have been reported.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mutation of this gene results in absence of NK cell production in spleen and bone marrow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,187,392 V698D probably benign Het
5530400C23Rik G A 6: 133,294,314 R107K probably benign Het
A530053G22Rik T C 6: 60,402,152 noncoding transcript Het
Adcy9 A G 16: 4,288,388 V954A probably damaging Het
Aldh8a1 T A 10: 21,395,539 M388K probably damaging Het
Ankhd1 A G 18: 36,646,766 I1720M probably damaging Het
Atp6v0a4 T C 6: 38,053,129 probably benign Het
C1qtnf4 T A 2: 90,890,363 *327R probably null Het
C1s1 T C 6: 124,541,318 probably benign Het
Cdsn A C 17: 35,556,138 R521S possibly damaging Het
Cgnl1 T C 9: 71,656,102 M848V probably benign Het
Cog3 A G 14: 75,722,140 S591P probably damaging Het
Col6a3 A G 1: 90,798,161 V1375A possibly damaging Het
Cr1l A G 1: 195,112,412 probably benign Het
Crmp1 T A 5: 37,284,135 D520E probably damaging Het
Ctdspl2 T A 2: 121,977,320 probably benign Het
Dnah6 C T 6: 73,155,279 A1147T probably damaging Het
Dsg2 T C 18: 20,602,054 S1030P probably benign Het
Elavl3 C A 9: 22,036,833 V12F possibly damaging Het
Fam20b T C 1: 156,690,570 E218G probably damaging Het
Fam227a T C 15: 79,620,832 D466G possibly damaging Het
Fto G A 8: 91,522,802 E421K probably damaging Het
Gab2 T C 7: 97,299,072 Y290H probably damaging Het
Gm973 A G 1: 59,582,474 Q591R probably null Het
Gsdmc2 T C 15: 63,828,177 T249A probably benign Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Il6ra A G 3: 89,876,818 I382T probably damaging Het
Isy1 G A 6: 87,819,185 R257W probably damaging Het
Krt76 T C 15: 101,884,912 T564A unknown Het
Lhpp T C 7: 132,630,525 S57P probably damaging Het
Lrrk1 G T 7: 66,292,341 D716E probably damaging Het
Mcm3ap T A 10: 76,499,534 D1263E probably damaging Het
Mogat1 A G 1: 78,523,670 T124A probably benign Het
Mroh7 T C 4: 106,711,270 T48A possibly damaging Het
Nccrp1 T C 7: 28,547,038 D33G probably benign Het
Neurog1 G T 13: 56,251,237 D232E probably benign Het
Olfr1202 T A 2: 88,817,909 V246D probably damaging Het
Olfr1243 T C 2: 89,528,363 T16A probably benign Het
Otog C A 7: 46,288,366 T1833K possibly damaging Het
Perm1 C A 4: 156,218,225 H409N probably benign Het
Pik3r5 A T 11: 68,490,511 E174D probably damaging Het
Pkhd1 G A 1: 20,523,732 Q1386* probably null Het
Pla2r1 T C 2: 60,514,981 R344G possibly damaging Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plekhg4 G A 8: 105,382,012 V1202M possibly damaging Het
Ppil4 A G 10: 7,798,446 Y118C probably damaging Het
Prrc2b G T 2: 32,213,311 E934* probably null Het
Psmb9 A G 17: 34,187,275 F12S probably benign Het
Ptdss2 T C 7: 141,152,880 W183R probably damaging Het
Ptpn4 C T 1: 119,687,605 probably null Het
Reln G A 5: 22,048,815 R600W probably damaging Het
Scml4 T A 10: 42,930,599 V161E probably damaging Het
Sdcbp2 A T 2: 151,589,558 T284S probably benign Het
Slc22a29 T C 19: 8,160,627 probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Spen T C 4: 141,469,810 probably benign Het
Sumf2 T A 5: 129,849,894 probably benign Het
Tbx10 A G 19: 3,993,121 probably benign Het
Tex10 C A 4: 48,468,957 V73F probably damaging Het
Tgm5 C A 2: 121,077,012 G77W probably damaging Het
Tnfrsf21 T A 17: 43,040,191 probably null Het
Treml2 C T 17: 48,302,828 T96I probably damaging Het
Trim65 T C 11: 116,126,066 *523W probably null Het
Zcchc17 T A 4: 130,349,306 D28V probably benign Het
Zhx2 T C 15: 57,822,695 F487L probably damaging Het
Zkscan6 T A 11: 65,821,985 L248Q probably damaging Het
Other mutations in Il15ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Il15ra APN 2 11733145 splice site probably benign
R0105:Il15ra UTSW 2 11730648 critical splice donor site probably null
R0945:Il15ra UTSW 2 11718327 missense probably damaging 0.96
R1863:Il15ra UTSW 2 11723436 missense possibly damaging 0.85
R1975:Il15ra UTSW 2 11723523 missense possibly damaging 0.94
R2172:Il15ra UTSW 2 11723571 missense possibly damaging 0.94
R2202:Il15ra UTSW 2 11718344 critical splice donor site probably null
R3709:Il15ra UTSW 2 11730647 critical splice donor site probably null
R3710:Il15ra UTSW 2 11730647 critical splice donor site probably null
R4621:Il15ra UTSW 2 11718329 missense possibly damaging 0.95
R4701:Il15ra UTSW 2 11718345 splice site probably null
R4779:Il15ra UTSW 2 11718306 missense probably damaging 0.98
R4844:Il15ra UTSW 2 11718271 start gained probably benign
R5237:Il15ra UTSW 2 11733205 missense possibly damaging 0.91
R5810:Il15ra UTSW 2 11733252 unclassified probably null
R5880:Il15ra UTSW 2 11730615 makesense probably null
R6160:Il15ra UTSW 2 11720016 missense probably damaging 0.99
R7291:Il15ra UTSW 2 11718381 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAAGAACATCCGTCCTGGGCAAG -3'
(R):5'- AGCTGCGCTGTGTCATTTCTGC -3'

Sequencing Primer
(F):5'- TCCTGGGCAAGAATGGAAATTAC -3'
(R):5'- CCCTGTATCATAGGGCTCAGTG -3'
Posted On2013-05-09