Incidental Mutation 'R0105:Spen'
ID33248
Institutional Source Beutler Lab
Gene Symbol Spen
Ensembl Gene ENSMUSG00000040761
Gene Namespen family transcription repressor
SynonymsMint
MMRRC Submission 038391-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0105 (G1)
Quality Score143
Status Validated (trace)
Chromosome4
Chromosomal Location141467890-141538597 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 141469810 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006377] [ENSMUST00000078886] [ENSMUST00000105786]
Predicted Effect probably benign
Transcript: ENSMUST00000006377
SMART Domains Protein: ENSMUSP00000006377
Gene: ENSMUSG00000006215

DomainStartEndE-ValueType
BTB 24 116 1.38e-27 SMART
low complexity region 203 222 N/A INTRINSIC
ZnF_C2H2 297 319 6.42e-4 SMART
ZnF_C2H2 325 347 3.11e-2 SMART
ZnF_C2H2 353 375 2.49e-1 SMART
ZnF_C2H2 381 403 8.47e-4 SMART
ZnF_C2H2 409 431 8.47e-4 SMART
ZnF_C2H2 437 459 1.22e-4 SMART
ZnF_C2H2 465 487 4.94e-5 SMART
ZnF_C2H2 493 515 3.26e-5 SMART
ZnF_C2H2 521 543 7.26e-3 SMART
ZnF_C2H2 549 571 4.79e-3 SMART
ZnF_C2H2 577 599 1.58e-3 SMART
ZnF_C2H2 605 628 2.57e-3 SMART
low complexity region 654 674 N/A INTRINSIC
ZnF_C2H2 708 730 4.4e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078886
SMART Domains Protein: ENSMUSP00000077925
Gene: ENSMUSG00000040761

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 617 632 N/A INTRINSIC
low complexity region 669 691 N/A INTRINSIC
low complexity region 695 720 N/A INTRINSIC
low complexity region 749 773 N/A INTRINSIC
coiled coil region 800 825 N/A INTRINSIC
low complexity region 830 841 N/A INTRINSIC
internal_repeat_2 844 954 6.27e-5 PROSPERO
coiled coil region 1494 1522 N/A INTRINSIC
low complexity region 1587 1627 N/A INTRINSIC
low complexity region 1635 1641 N/A INTRINSIC
low complexity region 1642 1671 N/A INTRINSIC
low complexity region 1747 1758 N/A INTRINSIC
low complexity region 1810 1823 N/A INTRINSIC
low complexity region 1888 1903 N/A INTRINSIC
low complexity region 1940 1955 N/A INTRINSIC
low complexity region 2003 2012 N/A INTRINSIC
internal_repeat_2 2015 2115 6.27e-5 PROSPERO
low complexity region 2127 2147 N/A INTRINSIC
low complexity region 2169 2191 N/A INTRINSIC
low complexity region 2207 2219 N/A INTRINSIC
low complexity region 2304 2323 N/A INTRINSIC
low complexity region 2332 2371 N/A INTRINSIC
low complexity region 2396 2413 N/A INTRINSIC
low complexity region 2518 2533 N/A INTRINSIC
low complexity region 2545 2555 N/A INTRINSIC
low complexity region 2696 2722 N/A INTRINSIC
low complexity region 2931 2942 N/A INTRINSIC
low complexity region 2994 3006 N/A INTRINSIC
low complexity region 3192 3212 N/A INTRINSIC
low complexity region 3299 3337 N/A INTRINSIC
Pfam:SPOC 3465 3586 2.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105786
SMART Domains Protein: ENSMUSP00000101412
Gene: ENSMUSG00000040761

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 692 714 N/A INTRINSIC
low complexity region 718 743 N/A INTRINSIC
low complexity region 772 796 N/A INTRINSIC
coiled coil region 823 848 N/A INTRINSIC
low complexity region 853 864 N/A INTRINSIC
internal_repeat_2 867 977 8.58e-5 PROSPERO
coiled coil region 1517 1545 N/A INTRINSIC
low complexity region 1610 1650 N/A INTRINSIC
low complexity region 1658 1664 N/A INTRINSIC
low complexity region 1665 1694 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1833 1846 N/A INTRINSIC
low complexity region 1911 1926 N/A INTRINSIC
low complexity region 1963 1978 N/A INTRINSIC
low complexity region 2026 2035 N/A INTRINSIC
internal_repeat_2 2038 2138 8.58e-5 PROSPERO
low complexity region 2150 2170 N/A INTRINSIC
low complexity region 2192 2214 N/A INTRINSIC
low complexity region 2230 2242 N/A INTRINSIC
low complexity region 2327 2346 N/A INTRINSIC
low complexity region 2355 2394 N/A INTRINSIC
low complexity region 2419 2436 N/A INTRINSIC
low complexity region 2541 2556 N/A INTRINSIC
low complexity region 2568 2578 N/A INTRINSIC
low complexity region 2719 2745 N/A INTRINSIC
low complexity region 2954 2965 N/A INTRINSIC
low complexity region 3017 3029 N/A INTRINSIC
low complexity region 3215 3235 N/A INTRINSIC
low complexity region 3322 3360 N/A INTRINSIC
Pfam:SPOC 3488 3609 2.7e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147227
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hormone inducible transcriptional repressor. Repression of transcription by this gene product can occur through interactions with other repressors, by the recruitment of proteins involved in histone deacetylation, or through sequestration of transcriptional activators. The product of this gene contains a carboxy-terminal domain that permits binding to other corepressor proteins. This domain also permits interaction with members of the NuRD complex, a nucleosome remodeling protein complex that contains deacetylase activity. In addition, this repressor contains several RNA recognition motifs that confer binding to a steroid receptor RNA coactivator; this binding can modulate the activity of both liganded and nonliganded steroid receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during late gestation exhibiting morphological abnormalities of the heart, pancreas, and liver. Inactivation of this gene also affects the differentiation of B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,187,392 V698D probably benign Het
5530400C23Rik G A 6: 133,294,314 R107K probably benign Het
A530053G22Rik T C 6: 60,402,152 noncoding transcript Het
Adcy9 A G 16: 4,288,388 V954A probably damaging Het
Aldh8a1 T A 10: 21,395,539 M388K probably damaging Het
Ankhd1 A G 18: 36,646,766 I1720M probably damaging Het
Atp6v0a4 T C 6: 38,053,129 probably benign Het
C1qtnf4 T A 2: 90,890,363 *327R probably null Het
C1s1 T C 6: 124,541,318 probably benign Het
Cdsn A C 17: 35,556,138 R521S possibly damaging Het
Cgnl1 T C 9: 71,656,102 M848V probably benign Het
Cog3 A G 14: 75,722,140 S591P probably damaging Het
Col6a3 A G 1: 90,798,161 V1375A possibly damaging Het
Cr1l A G 1: 195,112,412 probably benign Het
Crmp1 T A 5: 37,284,135 D520E probably damaging Het
Ctdspl2 T A 2: 121,977,320 probably benign Het
Dnah6 C T 6: 73,155,279 A1147T probably damaging Het
Dsg2 T C 18: 20,602,054 S1030P probably benign Het
Elavl3 C A 9: 22,036,833 V12F possibly damaging Het
Fam20b T C 1: 156,690,570 E218G probably damaging Het
Fam227a T C 15: 79,620,832 D466G possibly damaging Het
Fto G A 8: 91,522,802 E421K probably damaging Het
Gab2 T C 7: 97,299,072 Y290H probably damaging Het
Gm973 A G 1: 59,582,474 Q591R probably null Het
Gsdmc2 T C 15: 63,828,177 T249A probably benign Het
Il15ra T A 2: 11,730,648 probably null Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Il6ra A G 3: 89,876,818 I382T probably damaging Het
Isy1 G A 6: 87,819,185 R257W probably damaging Het
Krt76 T C 15: 101,884,912 T564A unknown Het
Lhpp T C 7: 132,630,525 S57P probably damaging Het
Lrrk1 G T 7: 66,292,341 D716E probably damaging Het
Mcm3ap T A 10: 76,499,534 D1263E probably damaging Het
Mogat1 A G 1: 78,523,670 T124A probably benign Het
Mroh7 T C 4: 106,711,270 T48A possibly damaging Het
Nccrp1 T C 7: 28,547,038 D33G probably benign Het
Neurog1 G T 13: 56,251,237 D232E probably benign Het
Olfr1202 T A 2: 88,817,909 V246D probably damaging Het
Olfr1243 T C 2: 89,528,363 T16A probably benign Het
Otog C A 7: 46,288,366 T1833K possibly damaging Het
Perm1 C A 4: 156,218,225 H409N probably benign Het
Pik3r5 A T 11: 68,490,511 E174D probably damaging Het
Pkhd1 G A 1: 20,523,732 Q1386* probably null Het
Pla2r1 T C 2: 60,514,981 R344G possibly damaging Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plekhg4 G A 8: 105,382,012 V1202M possibly damaging Het
Ppil4 A G 10: 7,798,446 Y118C probably damaging Het
Prrc2b G T 2: 32,213,311 E934* probably null Het
Psmb9 A G 17: 34,187,275 F12S probably benign Het
Ptdss2 T C 7: 141,152,880 W183R probably damaging Het
Ptpn4 C T 1: 119,687,605 probably null Het
Reln G A 5: 22,048,815 R600W probably damaging Het
Scml4 T A 10: 42,930,599 V161E probably damaging Het
Sdcbp2 A T 2: 151,589,558 T284S probably benign Het
Slc22a29 T C 19: 8,160,627 probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Sumf2 T A 5: 129,849,894 probably benign Het
Tbx10 A G 19: 3,993,121 probably benign Het
Tex10 C A 4: 48,468,957 V73F probably damaging Het
Tgm5 C A 2: 121,077,012 G77W probably damaging Het
Tnfrsf21 T A 17: 43,040,191 probably null Het
Treml2 C T 17: 48,302,828 T96I probably damaging Het
Trim65 T C 11: 116,126,066 *523W probably null Het
Zcchc17 T A 4: 130,349,306 D28V probably benign Het
Zhx2 T C 15: 57,822,695 F487L probably damaging Het
Zkscan6 T A 11: 65,821,985 L248Q probably damaging Het
Other mutations in Spen
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Spen APN 4 141489901 missense unknown
IGL01357:Spen APN 4 141517113 missense unknown
IGL02184:Spen APN 4 141487606 missense unknown
IGL02226:Spen APN 4 141478146 missense unknown
IGL02321:Spen APN 4 141517130 missense unknown
IGL02350:Spen APN 4 141477579 missense unknown
IGL02357:Spen APN 4 141477579 missense unknown
IGL02627:Spen APN 4 141473015 missense probably damaging 0.99
IGL02683:Spen APN 4 141471645 missense probably benign 0.06
IGL02945:Spen APN 4 141494313 missense unknown
IGL02950:Spen APN 4 141469508 missense probably damaging 1.00
IGL03008:Spen APN 4 141476137 missense possibly damaging 0.70
IGL03019:Spen APN 4 141478916 missense unknown
IGL03038:Spen APN 4 141538239 missense unknown
IGL03334:Spen APN 4 141469969 missense probably damaging 1.00
R0268:Spen UTSW 4 141477557 missense unknown
R0359:Spen UTSW 4 141516870 missense unknown
R0394:Spen UTSW 4 141474203 missense probably benign 0.03
R0423:Spen UTSW 4 141479336 missense unknown
R0433:Spen UTSW 4 141483758 missense unknown
R0462:Spen UTSW 4 141473651 missense probably damaging 1.00
R0687:Spen UTSW 4 141488028 missense unknown
R0699:Spen UTSW 4 141474391 missense possibly damaging 0.72
R0865:Spen UTSW 4 141471870 missense probably benign 0.11
R0918:Spen UTSW 4 141485564 missense unknown
R1034:Spen UTSW 4 141475752 missense probably benign 0.33
R1341:Spen UTSW 4 141469400 missense possibly damaging 0.78
R1401:Spen UTSW 4 141471821 missense probably damaging 0.98
R1509:Spen UTSW 4 141475635 missense probably benign 0.00
R1509:Spen UTSW 4 141475700 missense possibly damaging 0.53
R1561:Spen UTSW 4 141472383 nonsense probably null
R1589:Spen UTSW 4 141488024 missense unknown
R1640:Spen UTSW 4 141468943 missense probably damaging 0.98
R1758:Spen UTSW 4 141476375 missense unknown
R1764:Spen UTSW 4 141472950 missense probably damaging 1.00
R1824:Spen UTSW 4 141472785 missense probably damaging 1.00
R1899:Spen UTSW 4 141470343 missense probably benign 0.17
R1916:Spen UTSW 4 141472598 missense probably damaging 1.00
R2011:Spen UTSW 4 141473329 missense probably damaging 1.00
R2295:Spen UTSW 4 141477273 missense unknown
R2379:Spen UTSW 4 141516927 missense unknown
R2404:Spen UTSW 4 141477905 missense unknown
R3719:Spen UTSW 4 141517183 missense unknown
R3889:Spen UTSW 4 141477881 missense unknown
R3945:Spen UTSW 4 141477353 missense unknown
R4227:Spen UTSW 4 141522147 missense unknown
R4326:Spen UTSW 4 141477372 missense unknown
R4382:Spen UTSW 4 141473139 missense possibly damaging 0.88
R4542:Spen UTSW 4 141476786 missense unknown
R4757:Spen UTSW 4 141473079 nonsense probably null
R4771:Spen UTSW 4 141472596 missense probably benign 0.14
R5072:Spen UTSW 4 141522302 missense unknown
R5121:Spen UTSW 4 141476099 missense probably benign 0.00
R5176:Spen UTSW 4 141476276 missense unknown
R5290:Spen UTSW 4 141473816 missense probably damaging 1.00
R5291:Spen UTSW 4 141488079 missense unknown
R5293:Spen UTSW 4 141472406 missense possibly damaging 0.89
R5347:Spen UTSW 4 141471485 missense probably benign 0.26
R5511:Spen UTSW 4 141475064 missense possibly damaging 0.86
R5511:Spen UTSW 4 141516838 missense unknown
R5772:Spen UTSW 4 141478184 missense unknown
R5834:Spen UTSW 4 141471843 missense possibly damaging 0.63
R5858:Spen UTSW 4 141473871 missense probably benign 0.05
R6214:Spen UTSW 4 141479112 missense unknown
R6232:Spen UTSW 4 141517022 missense unknown
R6345:Spen UTSW 4 141471633 missense possibly damaging 0.86
R6419:Spen UTSW 4 141476310 missense unknown
R6455:Spen UTSW 4 141475509 missense probably damaging 0.97
R6979:Spen UTSW 4 141478063 missense unknown
R6994:Spen UTSW 4 141493459 missense unknown
R7018:Spen UTSW 4 141493444 missense unknown
R7040:Spen UTSW 4 141494382 missense unknown
R7127:Spen UTSW 4 141476108 missense possibly damaging 0.53
R7218:Spen UTSW 4 141472650 missense possibly damaging 0.54
R7234:Spen UTSW 4 141479135 missense unknown
R7316:Spen UTSW 4 141477054 missense unknown
R7350:Spen UTSW 4 141479385 missense unknown
R7356:Spen UTSW 4 141471924 nonsense probably null
R7400:Spen UTSW 4 141473741 missense probably damaging 1.00
R7470:Spen UTSW 4 141479294 missense unknown
T0722:Spen UTSW 4 141474353 missense probably benign 0.33
T0975:Spen UTSW 4 141474353 missense probably benign 0.33
Z1088:Spen UTSW 4 141477976 missense unknown
Z1088:Spen UTSW 4 141477977 missense unknown
Predicted Primers PCR Primer
(F):5'- ACAATGACCAACCTGATTGGAGCC -3'
(R):5'- GCTAAGCAGAAGTACCCCATCGTG -3'

Sequencing Primer
(F):5'- GTCCTAACTAAGTGCCCTAAGGTG -3'
(R):5'- TACCCCATCGTGTGGCAG -3'
Posted On2013-05-09