Incidental Mutation 'R0105:Gab2'
ID33263
Institutional Source Beutler Lab
Gene Symbol Gab2
Ensembl Gene ENSMUSG00000004508
Gene Namegrowth factor receptor bound protein 2-associated protein 2
SynonymsD130058I17Rik, p97
MMRRC Submission 038391-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.401) question?
Stock #R0105 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location97081586-97308946 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97299072 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 290 (Y290H)
Ref Sequence ENSEMBL: ENSMUSP00000146200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004622] [ENSMUST00000206791]
Predicted Effect probably damaging
Transcript: ENSMUST00000004622
AA Change: Y290H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004622
Gene: ENSMUSG00000004508
AA Change: Y290H

DomainStartEndE-ValueType
PH 9 121 1.07e-22 SMART
Blast:PH 268 314 4e-11 BLAST
low complexity region 348 355 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000206791
AA Change: Y290H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the GRB2-associated binding protein (GAB) gene family. These proteins contain pleckstrin homology (PH) domain, and bind SHP2 tyrosine phosphatase and GRB2 adapter protein. They act as adapters for transmitting various signals in response to stimuli through cytokine and growth factor receptors, and T- and B-cell antigen receptors. The protein encoded by this gene is the principal activator of phosphatidylinositol-3 kinase in response to activation of the high affinity IgE receptor. Two alternatively spliced transcripts encoding different isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in passive cutaneous and systemic anaphylaxis, Fc gamma receptor-mediated phagocytosis, and mast cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,187,392 V698D probably benign Het
5530400C23Rik G A 6: 133,294,314 R107K probably benign Het
A530053G22Rik T C 6: 60,402,152 noncoding transcript Het
Adcy9 A G 16: 4,288,388 V954A probably damaging Het
Aldh8a1 T A 10: 21,395,539 M388K probably damaging Het
Ankhd1 A G 18: 36,646,766 I1720M probably damaging Het
Atp6v0a4 T C 6: 38,053,129 probably benign Het
C1qtnf4 T A 2: 90,890,363 *327R probably null Het
C1s1 T C 6: 124,541,318 probably benign Het
Cdsn A C 17: 35,556,138 R521S possibly damaging Het
Cgnl1 T C 9: 71,656,102 M848V probably benign Het
Cog3 A G 14: 75,722,140 S591P probably damaging Het
Col6a3 A G 1: 90,798,161 V1375A possibly damaging Het
Cr1l A G 1: 195,112,412 probably benign Het
Crmp1 T A 5: 37,284,135 D520E probably damaging Het
Ctdspl2 T A 2: 121,977,320 probably benign Het
Dnah6 C T 6: 73,155,279 A1147T probably damaging Het
Dsg2 T C 18: 20,602,054 S1030P probably benign Het
Elavl3 C A 9: 22,036,833 V12F possibly damaging Het
Fam20b T C 1: 156,690,570 E218G probably damaging Het
Fam227a T C 15: 79,620,832 D466G possibly damaging Het
Fto G A 8: 91,522,802 E421K probably damaging Het
Gm973 A G 1: 59,582,474 Q591R probably null Het
Gsdmc2 T C 15: 63,828,177 T249A probably benign Het
Il15ra T A 2: 11,730,648 probably null Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Il6ra A G 3: 89,876,818 I382T probably damaging Het
Isy1 G A 6: 87,819,185 R257W probably damaging Het
Krt76 T C 15: 101,884,912 T564A unknown Het
Lhpp T C 7: 132,630,525 S57P probably damaging Het
Lrrk1 G T 7: 66,292,341 D716E probably damaging Het
Mcm3ap T A 10: 76,499,534 D1263E probably damaging Het
Mogat1 A G 1: 78,523,670 T124A probably benign Het
Mroh7 T C 4: 106,711,270 T48A possibly damaging Het
Nccrp1 T C 7: 28,547,038 D33G probably benign Het
Neurog1 G T 13: 56,251,237 D232E probably benign Het
Olfr1202 T A 2: 88,817,909 V246D probably damaging Het
Olfr1243 T C 2: 89,528,363 T16A probably benign Het
Otog C A 7: 46,288,366 T1833K possibly damaging Het
Perm1 C A 4: 156,218,225 H409N probably benign Het
Pik3r5 A T 11: 68,490,511 E174D probably damaging Het
Pkhd1 G A 1: 20,523,732 Q1386* probably null Het
Pla2r1 T C 2: 60,514,981 R344G possibly damaging Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plekhg4 G A 8: 105,382,012 V1202M possibly damaging Het
Ppil4 A G 10: 7,798,446 Y118C probably damaging Het
Prrc2b G T 2: 32,213,311 E934* probably null Het
Psmb9 A G 17: 34,187,275 F12S probably benign Het
Ptdss2 T C 7: 141,152,880 W183R probably damaging Het
Ptpn4 C T 1: 119,687,605 probably null Het
Reln G A 5: 22,048,815 R600W probably damaging Het
Scml4 T A 10: 42,930,599 V161E probably damaging Het
Sdcbp2 A T 2: 151,589,558 T284S probably benign Het
Slc22a29 T C 19: 8,160,627 probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Spen T C 4: 141,469,810 probably benign Het
Sumf2 T A 5: 129,849,894 probably benign Het
Tbx10 A G 19: 3,993,121 probably benign Het
Tex10 C A 4: 48,468,957 V73F probably damaging Het
Tgm5 C A 2: 121,077,012 G77W probably damaging Het
Tnfrsf21 T A 17: 43,040,191 probably null Het
Treml2 C T 17: 48,302,828 T96I probably damaging Het
Trim65 T C 11: 116,126,066 *523W probably null Het
Zcchc17 T A 4: 130,349,306 D28V probably benign Het
Zhx2 T C 15: 57,822,695 F487L probably damaging Het
Zkscan6 T A 11: 65,821,985 L248Q probably damaging Het
Other mutations in Gab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Gab2 APN 7 97302443 missense possibly damaging 0.91
IGL00325:Gab2 APN 7 97299258 missense probably damaging 1.00
IGL01832:Gab2 APN 7 97304238 missense probably damaging 1.00
IGL01955:Gab2 APN 7 97304223 missense probably damaging 1.00
IGL02664:Gab2 APN 7 97304182 missense probably damaging 1.00
R0105:Gab2 UTSW 7 97299072 missense probably damaging 1.00
R0243:Gab2 UTSW 7 97299241 missense probably damaging 0.96
R0827:Gab2 UTSW 7 97300332 missense probably damaging 1.00
R1696:Gab2 UTSW 7 97223633 missense probably damaging 1.00
R1872:Gab2 UTSW 7 97299043 missense probably damaging 0.99
R2973:Gab2 UTSW 7 97223552 missense probably benign 0.07
R3195:Gab2 UTSW 7 97272029 missense probably benign
R3827:Gab2 UTSW 7 97223741 missense probably damaging 1.00
R3910:Gab2 UTSW 7 97299073 missense probably damaging 1.00
R3911:Gab2 UTSW 7 97299073 missense probably damaging 1.00
R3912:Gab2 UTSW 7 97299073 missense probably damaging 1.00
R4604:Gab2 UTSW 7 97304213 missense probably damaging 0.99
R5506:Gab2 UTSW 7 97303113 missense probably damaging 1.00
R5655:Gab2 UTSW 7 97298892 missense probably benign
R6299:Gab2 UTSW 7 97081859 missense probably benign 0.00
R7038:Gab2 UTSW 7 97303083 missense probably damaging 1.00
R7313:Gab2 UTSW 7 97081798 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACTTGCCCAGAGCAATGGACAC -3'
(R):5'- GCTCCAGATTACACTGACCTCGATG -3'

Sequencing Primer
(F):5'- TGGACACTGTATCAACGGC -3'
(R):5'- GATTACACTGACCTCGATGGAGTC -3'
Posted On2013-05-09