Incidental Mutation 'R2091:Atp2b4'
ID332762
Institutional Source Beutler Lab
Gene Symbol Atp2b4
Ensembl Gene ENSMUSG00000026463
Gene NameATPase, Ca++ transporting, plasma membrane 4
SynonymsPMCA4
MMRRC Submission 040096-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock #R2091 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location133699457-133801041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 133715230 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 1046 (V1046F)
Ref Sequence ENSEMBL: ENSMUSP00000133187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048953] [ENSMUST00000112264] [ENSMUST00000125659] [ENSMUST00000143567] [ENSMUST00000165602]
Predicted Effect probably benign
Transcript: ENSMUST00000048953
AA Change: V1046F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000047978
Gene: ENSMUSG00000026463
AA Change: V1046F

DomainStartEndE-ValueType
Cation_ATPase_N 45 121 1.81e-8 SMART
low complexity region 140 152 N/A INTRINSIC
Pfam:E1-E2_ATPase 154 456 1.7e-58 PFAM
Pfam:Hydrolase 460 798 3e-26 PFAM
Pfam:HAD 463 795 7.4e-15 PFAM
Pfam:Hydrolase_like2 510 605 3.6e-17 PFAM
Pfam:Hydrolase_3 756 831 2.7e-6 PFAM
Pfam:Cation_ATPase_C 868 1050 1.1e-43 PFAM
Pfam:ATP_Ca_trans_C 1090 1153 1.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112264
AA Change: V1046F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000107883
Gene: ENSMUSG00000026463
AA Change: V1046F

DomainStartEndE-ValueType
Cation_ATPase_N 45 121 1.81e-8 SMART
low complexity region 140 152 N/A INTRINSIC
Pfam:E1-E2_ATPase 154 456 1.3e-58 PFAM
Pfam:Hydrolase 460 798 1.2e-26 PFAM
Pfam:HAD 463 795 3.5e-15 PFAM
Pfam:Hydrolase_like2 510 605 4.6e-17 PFAM
Pfam:Hydrolase_3 756 831 9.1e-7 PFAM
Pfam:Cation_ATPase_C 868 1050 1.1e-43 PFAM
Pfam:ATP_Ca_trans_C 1090 1104 7.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125659
AA Change: V1046F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000116941
Gene: ENSMUSG00000026463
AA Change: V1046F

DomainStartEndE-ValueType
Cation_ATPase_N 45 121 1.81e-8 SMART
low complexity region 140 152 N/A INTRINSIC
Pfam:E1-E2_ATPase 154 456 1.7e-58 PFAM
Pfam:Hydrolase 460 798 3e-26 PFAM
Pfam:HAD 463 795 7.4e-15 PFAM
Pfam:Hydrolase_like2 510 605 3.6e-17 PFAM
Pfam:Hydrolase_3 756 831 2.7e-6 PFAM
Pfam:Cation_ATPase_C 868 1050 1.1e-43 PFAM
Pfam:ATP_Ca_trans_C 1090 1153 1.8e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140810
Predicted Effect probably benign
Transcript: ENSMUST00000143567
AA Change: V1046F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000119242
Gene: ENSMUSG00000026463
AA Change: V1046F

DomainStartEndE-ValueType
Cation_ATPase_N 45 121 1.81e-8 SMART
low complexity region 140 152 N/A INTRINSIC
Pfam:E1-E2_ATPase 153 301 6.8e-29 PFAM
Pfam:E1-E2_ATPase 338 455 1.9e-13 PFAM
Pfam:HAD 463 795 1e-21 PFAM
Pfam:Cation_ATPase 509 605 5.8e-17 PFAM
Pfam:Hydrolase 577 798 5e-15 PFAM
Pfam:Hydrolase_3 756 831 6.6e-7 PFAM
Pfam:Cation_ATPase_C 868 1050 4.5e-45 PFAM
Pfam:ATP_Ca_trans_C 1090 1141 3.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165602
AA Change: V1046F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000133187
Gene: ENSMUSG00000026463
AA Change: V1046F

DomainStartEndE-ValueType
Cation_ATPase_N 45 121 1.81e-8 SMART
low complexity region 140 152 N/A INTRINSIC
Pfam:E1-E2_ATPase 154 456 1.5e-58 PFAM
Pfam:Hydrolase 460 798 1.4e-26 PFAM
Pfam:HAD 463 795 4.1e-15 PFAM
Pfam:Hydrolase_like2 510 605 5.1e-17 PFAM
Pfam:Hydrolase_3 756 831 1e-6 PFAM
Pfam:Cation_ATPase_C 868 1050 1.3e-43 PFAM
Pfam:ATP_Ca_trans_C 1090 1151 4.8e-26 PFAM
Meta Mutation Damage Score 0.1232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type primary ion transport ATPases characterized by the formation of an aspartyl phosphate intermediate during the reaction cycle. These enzymes remove bivalent calcium ions from eukaryotic cells against very large concentration gradients and play a critical role in intracellular calcium homeostasis. The mammalian plasma membrane calcium ATPase isoforms are encoded by at least four separate genes and the diversity of these enzymes is further increased by alternative splicing of transcripts. The expression of different isoforms and splice variants is regulated in a developmental, tissue- and cell type-specific manner, suggesting that these pumps are functionally adapted to the physiological needs of particular cells and tissues. This gene encodes the plasma membrane calcium ATPase isoform 4. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display male infertility with impaired sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G C 2: 19,517,546 N247K probably damaging Het
4930402F06Rik T C 2: 35,376,067 K197R probably benign Het
4932438A13Rik C T 3: 36,988,256 T2797I probably damaging Het
4932438A13Rik T C 3: 36,953,970 V1725A probably damaging Het
9130011E15Rik A T 19: 45,952,680 L300Q probably damaging Het
AA986860 T C 1: 130,743,169 L376P probably benign Het
Adamts10 T C 17: 33,551,192 probably null Het
Adamts7 T C 9: 90,188,440 probably null Het
Adgrl1 T C 8: 83,934,464 I862T probably damaging Het
Agbl1 G A 7: 76,589,500 V583M probably damaging Het
Apba2 T A 7: 64,695,593 V177D probably benign Het
Arfgap2 A G 2: 91,270,241 K297R probably benign Het
Atg14 A T 14: 47,542,895 I474N probably damaging Het
Best1 A G 19: 9,992,079 V205A probably benign Het
Bicdl1 A G 5: 115,724,579 S206P probably damaging Het
Cacna1h C T 17: 25,432,876 C98Y possibly damaging Het
Calhm3 T A 19: 47,151,991 D221V probably damaging Het
Ccdc93 T A 1: 121,483,342 probably null Het
Cd248 A T 19: 5,070,046 I641F possibly damaging Het
Chrnb3 C T 8: 27,394,234 T333M probably damaging Het
Cyb5rl A G 4: 107,071,006 H113R probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddx59 T A 1: 136,416,709 D39E probably benign Het
Defa5 A G 8: 21,297,497 D20G probably damaging Het
Dido1 A T 2: 180,661,884 V1409E probably benign Het
Dlc1 A T 8: 36,937,609 V342E probably benign Het
Dsc2 G A 18: 20,033,294 T760I possibly damaging Het
Dync1h1 A G 12: 110,649,588 I3057V probably benign Het
Etnk2 T G 1: 133,377,053 probably null Het
Fbp2 G T 13: 62,858,207 L31I probably damaging Het
Gbp7 A T 3: 142,534,622 I34F probably damaging Het
Gcfc2 A G 6: 81,943,479 E415G probably damaging Het
Glp1r T C 17: 30,925,549 L232P probably damaging Het
Gm10822 A G 2: 73,899,275 noncoding transcript Het
Gm42669 G A 5: 107,507,910 V1192M probably benign Het
Gpr37 A G 6: 25,689,063 S12P possibly damaging Het
Gpt A G 15: 76,697,976 E211G possibly damaging Het
Grxcr1 T C 5: 68,110,412 I168T probably damaging Het
Hat1 T C 2: 71,434,034 V272A probably benign Het
Igkv8-30 A C 6: 70,117,086 C114G probably damaging Het
Kcne4 T C 1: 78,817,907 S91P probably benign Het
Kif5b G A 18: 6,213,248 Q715* probably null Het
Lamb1 T A 12: 31,287,429 N386K probably damaging Het
Lcmt2 T C 2: 121,138,616 N662S probably damaging Het
Lnx1 G T 5: 74,620,066 H324N probably benign Het
Lrrc4 T G 6: 28,830,587 D343A probably benign Het
Mars A G 10: 127,299,285 S646P probably damaging Het
Mboat7 T C 7: 3,684,011 probably benign Het
Mlip C T 9: 77,164,863 V341I possibly damaging Het
Mterf1b A T 5: 4,197,057 T233S possibly damaging Het
Myo3a A T 2: 22,333,677 H442L probably damaging Het
Myrf A T 19: 10,224,600 V171D possibly damaging Het
Nbas G A 12: 13,361,045 D897N probably benign Het
Nfx1 T C 4: 40,977,004 V226A probably benign Het
Nlrp4a T C 7: 26,450,153 L395P probably damaging Het
Nrros C T 16: 32,144,157 W311* probably null Het
Nsun6 A G 2: 15,039,731 probably null Het
Ntrk2 A G 13: 58,859,301 H239R possibly damaging Het
Olfr1301 A T 2: 111,754,386 M46L probably benign Het
Olfr259 T C 2: 87,108,262 N42D probably damaging Het
Olfr495 A G 7: 108,395,861 H247R probably damaging Het
Olfr979 T C 9: 40,001,204 T8A probably benign Het
Pate4 C A 9: 35,608,257 A46S possibly damaging Het
Pcdhb18 T C 18: 37,490,600 S328P probably damaging Het
Pdk4 A G 6: 5,494,857 probably benign Het
Pigm T C 1: 172,377,533 Y279H probably damaging Het
Pla2g16 A G 19: 7,579,109 I92V probably damaging Het
Plxdc2 A G 2: 16,713,683 I379M probably damaging Het
Ppp1r35 A G 5: 137,779,894 N217S possibly damaging Het
Prex1 G A 2: 166,569,365 T1438I possibly damaging Het
Ptger4 T A 15: 5,242,845 I98F possibly damaging Het
Rasl11a T A 5: 146,847,117 I124N probably damaging Het
Rest A G 5: 77,281,279 K515R possibly damaging Het
Ryr1 A G 7: 29,086,049 L1746P probably damaging Het
Ryr2 G T 13: 11,945,977 T25K probably benign Het
Sacs A T 14: 61,191,919 I476L possibly damaging Het
Serpina3g A T 12: 104,239,158 D52V probably damaging Het
Skint6 T C 4: 112,846,684 N998S probably benign Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc10a4 G A 5: 73,017,139 probably benign Het
Slc24a2 G T 4: 87,011,646 P538T probably damaging Het
Sntg1 T A 1: 8,595,539 T184S probably benign Het
Ssbp1 A G 6: 40,476,499 Y73C probably null Het
St18 G A 1: 6,827,971 V666M probably benign Het
Suclg1 A G 6: 73,264,276 K193R probably benign Het
Tcp11l1 T C 2: 104,684,139 I428V possibly damaging Het
Th T A 7: 142,895,543 D275V probably damaging Het
Tnrc18 A C 5: 142,773,641 S813R unknown Het
Tnrc6a T C 7: 123,172,120 probably null Het
Trap1 A C 16: 4,046,039 Y472* probably null Het
Trdv1 C A 14: 53,882,169 Q96K probably benign Het
Trpm8 T C 1: 88,343,326 I446T probably damaging Het
Tti2 T C 8: 31,154,266 L297P probably damaging Het
Ttn C T 2: 76,735,011 G26545R probably damaging Het
Ttn T C 2: 76,757,144 D13208G probably damaging Het
Tubb3 A G 8: 123,421,678 probably null Het
Umodl1 A G 17: 30,971,919 M247V probably benign Het
Wrn T A 8: 33,267,825 H812L probably benign Het
Zfp174 A G 16: 3,854,642 R352G possibly damaging Het
Zfp955a T A 17: 33,242,757 K134* probably null Het
Other mutations in Atp2b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02387:Atp2b4 APN 1 133731889 missense probably damaging 1.00
IGL02887:Atp2b4 APN 1 133728774 missense probably damaging 1.00
IGL02964:Atp2b4 APN 1 133730565 missense probably damaging 1.00
IGL03116:Atp2b4 APN 1 133728768 missense possibly damaging 0.95
IGL03227:Atp2b4 APN 1 133729707 splice site probably benign
R0018:Atp2b4 UTSW 1 133717871 missense probably damaging 1.00
R0018:Atp2b4 UTSW 1 133717871 missense probably damaging 1.00
R0279:Atp2b4 UTSW 1 133729702 splice site probably benign
R0455:Atp2b4 UTSW 1 133728716 missense probably damaging 1.00
R0511:Atp2b4 UTSW 1 133732218 splice site probably benign
R0712:Atp2b4 UTSW 1 133730478 missense probably damaging 1.00
R1469:Atp2b4 UTSW 1 133706939 missense probably damaging 0.97
R1469:Atp2b4 UTSW 1 133706939 missense probably damaging 0.97
R1529:Atp2b4 UTSW 1 133717988 missense probably damaging 1.00
R1771:Atp2b4 UTSW 1 133732393 missense probably damaging 0.96
R1954:Atp2b4 UTSW 1 133739992 missense probably damaging 1.00
R2054:Atp2b4 UTSW 1 133715169 missense probably benign 0.03
R2056:Atp2b4 UTSW 1 133726537 missense probably benign 0.36
R2059:Atp2b4 UTSW 1 133726537 missense probably benign 0.36
R2263:Atp2b4 UTSW 1 133726533 missense probably benign 0.35
R3907:Atp2b4 UTSW 1 133738586 missense probably damaging 1.00
R4362:Atp2b4 UTSW 1 133739931 missense possibly damaging 0.94
R4756:Atp2b4 UTSW 1 133711791 missense probably benign 0.00
R4756:Atp2b4 UTSW 1 133739396 missense probably benign 0.41
R4856:Atp2b4 UTSW 1 133706780 missense probably benign 0.00
R4886:Atp2b4 UTSW 1 133706780 missense probably benign 0.00
R5177:Atp2b4 UTSW 1 133728768 missense probably benign 0.00
R5454:Atp2b4 UTSW 1 133729872 missense probably damaging 1.00
R5594:Atp2b4 UTSW 1 133730510 missense probably damaging 1.00
R5712:Atp2b4 UTSW 1 133730540 missense probably damaging 1.00
R6034:Atp2b4 UTSW 1 133731907 critical splice acceptor site probably null
R6034:Atp2b4 UTSW 1 133731907 critical splice acceptor site probably null
R6078:Atp2b4 UTSW 1 133701702 small insertion probably benign
R6079:Atp2b4 UTSW 1 133701702 small insertion probably benign
R6244:Atp2b4 UTSW 1 133726561 missense probably damaging 1.00
R6376:Atp2b4 UTSW 1 133715059 missense probably damaging 1.00
R6483:Atp2b4 UTSW 1 133729880 missense possibly damaging 0.68
R6526:Atp2b4 UTSW 1 133711729 missense probably damaging 0.99
R6725:Atp2b4 UTSW 1 133706987 missense probably benign 0.01
R6801:Atp2b4 UTSW 1 133727786 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACCTGAGTCTGAATCCGGTTC -3'
(R):5'- AGGAATCAAGTCCCCTTCTGTG -3'

Sequencing Primer
(F):5'- TGAATCCGGTTCAGGCCAC -3'
(R):5'- TGTGTCCACAAATGCTGGCAC -3'
Posted On2015-08-13