Incidental Mutation 'R3411:Aff1'
List |< first << previous [record 61 of 1308] next >> last >|
ID332766
Institutional Source Beutler Lab
Gene Symbol Aff1
Ensembl Gene ENSMUSG00000029313
Gene NameAF4/FMR2 family, member 1
Synonyms9630032B01Rik, Af4, Rob, Mllt2h
MMRRC Submission 040629-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.268) question?
Stock #R3411 (G1)
Quality Score31
Status Validated
Chromosome5
Chromosomal Location103692374-103855322 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 103754706 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000119631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031256] [ENSMUST00000054979] [ENSMUST00000153165]
Predicted Effect probably null
Transcript: ENSMUST00000031256
AA Change: M1K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000031256
Gene: ENSMUSG00000029313
AA Change: M1K

DomainStartEndE-ValueType
Pfam:AF-4 16 1223 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054979
SMART Domains Protein: ENSMUSP00000059744
Gene: ENSMUSG00000029313

DomainStartEndE-ValueType
Pfam:AF-4 8 1216 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126335
Predicted Effect probably null
Transcript: ENSMUST00000153165
AA Change: M1K

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119631
Gene: ENSMUSG00000029313
AA Change: M1K

DomainStartEndE-ValueType
Pfam:AF-4 16 871 N/A PFAM
Meta Mutation Damage Score 0.6336 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes a member of the AF4/ lymphoid nuclear protein related to AF4/Fragile X E mental retardation syndrome family of proteins, which have been implicated in human childhood lymphoblastic leukemia, Fragile X E site mental retardation, and ataxia. It is the prevalent mixed-lineage leukemia fusion gene associated with spontaneous acute lymphoblastic leukemia. Members of this family have three conserved domains: an N-terminal homology domain, an AF4/ lymphoid nuclear protein related to AF4/Fragile X E mental retardation syndrome domain, and a C-terminal homology domain. Knockout of the mouse gene by homologous recombination severely affects early events in lymphopoiesis, including precursor proliferation or recruitment, but is dispensable for terminal differentiation. In addition, an autosomal dominant missense mutation results in several phenotypes including ataxia and adult-onset Purkinje cell loss in the cerebellum, indicating a role in Purkinje cell maintenance and function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired B and T cell development. Heterozygotes for an ENU-induced mutation exhibit small size, ataxia, adult-onset Purkinje cell loss, cataracts, reduced survival, and low fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,419,822 V675D possibly damaging Het
Adamts16 T C 13: 70,753,226 T911A probably benign Het
Adgra1 T C 7: 139,847,703 F62S possibly damaging Het
Adgra3 A G 5: 50,001,930 V326A probably damaging Het
AI429214 C T 8: 36,993,917 S73L probably benign Het
Apc C A 18: 34,269,259 probably benign Het
Apcs T C 1: 172,894,563 Y72C probably damaging Het
Arid4a T C 12: 71,061,525 probably benign Het
Armcx4 C A X: 134,691,025 Q561K probably benign Het
Atp5o C T 16: 91,928,906 R64H probably damaging Het
Bank1 G A 3: 136,247,773 probably benign Het
Ccdc150 A G 1: 54,356,773 D805G probably benign Het
Ccdc88a T A 11: 29,486,006 C10S probably damaging Het
Dnah1 A T 14: 31,269,817 M3076K possibly damaging Het
Dnpep A G 1: 75,316,626 V33A probably damaging Het
Egfem1 C T 3: 29,583,021 T202I probably damaging Het
Fam120b T A 17: 15,431,635 probably benign Het
Frem1 T C 4: 82,963,179 T1263A possibly damaging Het
Gm6802 C A 12: 19,490,620 noncoding transcript Het
Golga2 C A 2: 32,302,942 A424E probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Grik5 T C 7: 25,062,972 D198G probably benign Het
Hcrtr2 A G 9: 76,233,008 F333L probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Htr1b A C 9: 81,632,041 V171G probably benign Het
Kalrn G T 16: 34,212,272 D1117E probably benign Het
Kcp T C 6: 29,482,846 N1408S possibly damaging Het
Klhl7 G T 5: 24,138,321 V212L probably damaging Het
Klra17 T A 6: 129,874,846 N21I probably damaging Het
Lrrc8d A T 5: 105,826,706 noncoding transcript Het
Mast2 C G 4: 116,310,910 E881Q possibly damaging Het
Mcm6 T C 1: 128,351,585 T155A probably benign Het
Mslnl T C 17: 25,744,517 F326L probably benign Het
Nlrp4c A G 7: 6,092,570 K816E possibly damaging Het
Olfr1047 T C 2: 86,228,642 S110G probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr1510 T A 14: 52,410,361 R170S possibly damaging Het
Olfr494 A T 7: 108,368,344 I285F possibly damaging Het
Otoa A G 7: 121,122,043 Q427R probably damaging Het
Pcdhb6 A G 18: 37,335,892 E622G probably damaging Het
Pdzd8 A G 19: 59,345,413 Y59H probably damaging Het
Psmc3 A C 2: 91,055,918 D159A probably damaging Het
Ripk4 T C 16: 97,743,957 T434A probably benign Het
Rpn2 C A 2: 157,290,652 A108E possibly damaging Het
Serpina3n A G 12: 104,411,277 E263G possibly damaging Het
Six4 A G 12: 73,112,883 F101S probably damaging Het
Slc16a4 G A 3: 107,300,872 E233K probably benign Het
Smu1 T C 4: 40,752,008 T183A probably benign Het
Sptb T G 12: 76,610,815 K1311Q possibly damaging Het
Styxl1 T C 5: 135,765,764 Y83C probably damaging Het
Sypl2 C T 3: 108,216,729 V166I possibly damaging Het
Tal2 A G 4: 53,785,843 N8S probably damaging Het
Tenm4 T C 7: 96,852,530 Y1314H probably damaging Het
Ttn A C 2: 76,942,405 N2415K possibly damaging Het
Usp53 T C 3: 122,949,858 probably null Het
Vmn2r65 T C 7: 84,946,688 I263V probably benign Het
Other mutations in Aff1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Aff1 APN 5 103784077 missense probably damaging 1.00
IGL02060:Aff1 APN 5 103783849 missense possibly damaging 0.51
IGL02081:Aff1 APN 5 103834305 missense probably damaging 1.00
IGL02108:Aff1 APN 5 103811109 critical splice donor site probably null
IGL03056:Aff1 APN 5 103811081 missense probably damaging 0.99
IGL03332:Aff1 APN 5 103841105 nonsense probably null
IGL03340:Aff1 APN 5 103783804 missense possibly damaging 0.76
IGL03382:Aff1 APN 5 103841060 missense possibly damaging 0.86
R0013:Aff1 UTSW 5 103828484 nonsense probably null
R0219:Aff1 UTSW 5 103811040 splice site probably benign
R0520:Aff1 UTSW 5 103847751 nonsense probably null
R0607:Aff1 UTSW 5 103828454 missense probably damaging 1.00
R0883:Aff1 UTSW 5 103826138 splice site probably benign
R1662:Aff1 UTSW 5 103841057 missense probably damaging 0.99
R1730:Aff1 UTSW 5 103833512 missense probably damaging 1.00
R1850:Aff1 UTSW 5 103833907 missense probably damaging 1.00
R4007:Aff1 UTSW 5 103784222 missense probably benign 0.15
R4207:Aff1 UTSW 5 103818988 critical splice donor site probably null
R4702:Aff1 UTSW 5 103811069 missense probably damaging 1.00
R4730:Aff1 UTSW 5 103843073 missense possibly damaging 0.95
R4784:Aff1 UTSW 5 103847039 nonsense probably null
R5166:Aff1 UTSW 5 103754657 start gained probably benign
R5294:Aff1 UTSW 5 103811157 intron probably benign
R5435:Aff1 UTSW 5 103754332 unclassified probably benign
R5436:Aff1 UTSW 5 103783870 missense probably damaging 1.00
R6065:Aff1 UTSW 5 103842252 missense probably damaging 1.00
R6114:Aff1 UTSW 5 103842297 missense probably damaging 0.97
R6298:Aff1 UTSW 5 103754720 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AAGTGTGTGAACCGAGTGC -3'
(R):5'- AACTGCGGGTCATTAGCCAG -3'

Sequencing Primer
(F):5'- CCGCCCGGAAAGTTAAGG -3'
(R):5'- GGTCATTAGCCAGGCTCC -3'
Posted On2015-08-17