Incidental Mutation 'R0105:Cog3'
ID33279
Institutional Source Beutler Lab
Gene Symbol Cog3
Ensembl Gene ENSMUSG00000034893
Gene Namecomponent of oligomeric golgi complex 3
Synonyms
MMRRC Submission 038391-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0105 (G1)
Quality Score225
Status Validated (trace)
Chromosome14
Chromosomal Location75702350-75754517 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75722140 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 591 (S591P)
Ref Sequence ENSEMBL: ENSMUSP00000045016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049168] [ENSMUST00000227473]
Predicted Effect probably damaging
Transcript: ENSMUST00000049168
AA Change: S591P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045016
Gene: ENSMUSG00000034893
AA Change: S591P

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Sec34 130 277 9.5e-57 PFAM
Blast:HisKA 745 810 1e-5 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226686
Predicted Effect probably damaging
Transcript: ENSMUST00000227473
AA Change: S581P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.36 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the conserved oligomeric Golgi (COG) complex which is composed of eight different subunits and is required for normal Golgi morphology and localization. Defects in the COG complex result in multiple deficiencies in protein glycosylation. The protein encoded by this gene is involved in ER-Golgi transport.[provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,187,392 V698D probably benign Het
5530400C23Rik G A 6: 133,294,314 R107K probably benign Het
A530053G22Rik T C 6: 60,402,152 noncoding transcript Het
Adcy9 A G 16: 4,288,388 V954A probably damaging Het
Aldh8a1 T A 10: 21,395,539 M388K probably damaging Het
Ankhd1 A G 18: 36,646,766 I1720M probably damaging Het
Atp6v0a4 T C 6: 38,053,129 probably benign Het
C1qtnf4 T A 2: 90,890,363 *327R probably null Het
C1s1 T C 6: 124,541,318 probably benign Het
Cdsn A C 17: 35,556,138 R521S possibly damaging Het
Cgnl1 T C 9: 71,656,102 M848V probably benign Het
Col6a3 A G 1: 90,798,161 V1375A possibly damaging Het
Cr1l A G 1: 195,112,412 probably benign Het
Crmp1 T A 5: 37,284,135 D520E probably damaging Het
Ctdspl2 T A 2: 121,977,320 probably benign Het
Dnah6 C T 6: 73,155,279 A1147T probably damaging Het
Dsg2 T C 18: 20,602,054 S1030P probably benign Het
Elavl3 C A 9: 22,036,833 V12F possibly damaging Het
Fam20b T C 1: 156,690,570 E218G probably damaging Het
Fam227a T C 15: 79,620,832 D466G possibly damaging Het
Fto G A 8: 91,522,802 E421K probably damaging Het
Gab2 T C 7: 97,299,072 Y290H probably damaging Het
Gm973 A G 1: 59,582,474 Q591R probably null Het
Gsdmc2 T C 15: 63,828,177 T249A probably benign Het
Il15ra T A 2: 11,730,648 probably null Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Il6ra A G 3: 89,876,818 I382T probably damaging Het
Isy1 G A 6: 87,819,185 R257W probably damaging Het
Krt76 T C 15: 101,884,912 T564A unknown Het
Lhpp T C 7: 132,630,525 S57P probably damaging Het
Lrrk1 G T 7: 66,292,341 D716E probably damaging Het
Mcm3ap T A 10: 76,499,534 D1263E probably damaging Het
Mogat1 A G 1: 78,523,670 T124A probably benign Het
Mroh7 T C 4: 106,711,270 T48A possibly damaging Het
Nccrp1 T C 7: 28,547,038 D33G probably benign Het
Neurog1 G T 13: 56,251,237 D232E probably benign Het
Olfr1202 T A 2: 88,817,909 V246D probably damaging Het
Olfr1243 T C 2: 89,528,363 T16A probably benign Het
Otog C A 7: 46,288,366 T1833K possibly damaging Het
Perm1 C A 4: 156,218,225 H409N probably benign Het
Pik3r5 A T 11: 68,490,511 E174D probably damaging Het
Pkhd1 G A 1: 20,523,732 Q1386* probably null Het
Pla2r1 T C 2: 60,514,981 R344G possibly damaging Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plekhg4 G A 8: 105,382,012 V1202M possibly damaging Het
Ppil4 A G 10: 7,798,446 Y118C probably damaging Het
Prrc2b G T 2: 32,213,311 E934* probably null Het
Psmb9 A G 17: 34,187,275 F12S probably benign Het
Ptdss2 T C 7: 141,152,880 W183R probably damaging Het
Ptpn4 C T 1: 119,687,605 probably null Het
Reln G A 5: 22,048,815 R600W probably damaging Het
Scml4 T A 10: 42,930,599 V161E probably damaging Het
Sdcbp2 A T 2: 151,589,558 T284S probably benign Het
Slc22a29 T C 19: 8,160,627 probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Spen T C 4: 141,469,810 probably benign Het
Sumf2 T A 5: 129,849,894 probably benign Het
Tbx10 A G 19: 3,993,121 probably benign Het
Tex10 C A 4: 48,468,957 V73F probably damaging Het
Tgm5 C A 2: 121,077,012 G77W probably damaging Het
Tnfrsf21 T A 17: 43,040,191 probably null Het
Treml2 C T 17: 48,302,828 T96I probably damaging Het
Trim65 T C 11: 116,126,066 *523W probably null Het
Zcchc17 T A 4: 130,349,306 D28V probably benign Het
Zhx2 T C 15: 57,822,695 F487L probably damaging Het
Zkscan6 T A 11: 65,821,985 L248Q probably damaging Het
Other mutations in Cog3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Cog3 APN 14 75730604 missense possibly damaging 0.79
IGL02637:Cog3 APN 14 75722196 splice site probably benign
IGL02934:Cog3 APN 14 75741689 missense probably damaging 0.99
R0105:Cog3 UTSW 14 75722140 missense probably damaging 0.99
R0403:Cog3 UTSW 14 75742327 splice site probably benign
R0972:Cog3 UTSW 14 75717170 missense probably benign
R1735:Cog3 UTSW 14 75729321 nonsense probably null
R1813:Cog3 UTSW 14 75742344 missense probably benign 0.03
R1896:Cog3 UTSW 14 75742344 missense probably benign 0.03
R2517:Cog3 UTSW 14 75741742 missense probably benign 0.01
R2567:Cog3 UTSW 14 75754290 missense probably benign
R2962:Cog3 UTSW 14 75740534 critical splice donor site probably null
R3103:Cog3 UTSW 14 75747201 critical splice acceptor site probably null
R3689:Cog3 UTSW 14 75754438 start codon destroyed probably null
R3691:Cog3 UTSW 14 75754438 start codon destroyed probably null
R3927:Cog3 UTSW 14 75743558 splice site probably benign
R4581:Cog3 UTSW 14 75732951 missense probably benign 0.04
R4932:Cog3 UTSW 14 75732954 missense probably damaging 0.98
R5560:Cog3 UTSW 14 75729393 missense probably damaging 1.00
R5654:Cog3 UTSW 14 75724799 missense probably benign 0.03
R6253:Cog3 UTSW 14 75719712 missense probably damaging 1.00
R6419:Cog3 UTSW 14 75724738 nonsense probably null
R6791:Cog3 UTSW 14 75730678 missense probably damaging 1.00
R6803:Cog3 UTSW 14 75704039 missense probably benign 0.00
R7015:Cog3 UTSW 14 75713276 missense possibly damaging 0.81
X0017:Cog3 UTSW 14 75741741 missense probably benign 0.01
X0021:Cog3 UTSW 14 75743593 missense possibly damaging 0.87
X0066:Cog3 UTSW 14 75741741 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAGCAGTCCTCTGTGAGCACTAC -3'
(R):5'- TAAAGGCCCTCCGAGCATTTCCAG -3'

Sequencing Primer
(F):5'- TCCCTCAAAGGGTCTCGAAATTC -3'
(R):5'- CATTTCCAGACACGAGTGC -3'
Posted On2013-05-09