Incidental Mutation 'R4514:Ifit1'
ID332827
Institutional Source Beutler Lab
Gene Symbol Ifit1
Ensembl Gene ENSMUSG00000034459
Gene Nameinterferon-induced protein with tetratricopeptide repeats 1
SynonymsIfi56, ISG56
MMRRC Submission 041588-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4514 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location34640871-34650009 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 34648513 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 350 (R350*)
Ref Sequence ENSEMBL: ENSMUSP00000099888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102824]
Predicted Effect probably null
Transcript: ENSMUST00000102824
AA Change: R350*
SMART Domains Protein: ENSMUSP00000099888
Gene: ENSMUSG00000034459
AA Change: R350*

DomainStartEndE-ValueType
TPR 52 85 4.8e1 SMART
TPR 92 125 6.92e1 SMART
TPR 138 171 1.2e1 SMART
low complexity region 210 221 N/A INTRINSIC
low complexity region 223 234 N/A INTRINSIC
TPR 242 275 4.93e1 SMART
TPR 329 362 3.89e1 SMART
TPR 426 459 1.45e-1 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered response to vesicular stomatitis virus (VSV) infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 T G 8: 24,818,136 T51P probably damaging Het
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Alg9 C T 9: 50,805,354 T409M possibly damaging Het
Arpp21 T A 9: 112,177,677 T155S probably damaging Het
Atm T A 9: 53,493,039 Q1334L probably damaging Het
Bptf G A 11: 107,077,692 T1055M probably damaging Het
Cd3g C A 9: 44,973,584 A121S possibly damaging Het
Cenpn A G 8: 116,933,396 Y68C probably damaging Het
Clock A G 5: 76,230,199 I618T probably benign Het
Cp A G 3: 19,988,013 M982V probably damaging Het
Csf3r T A 4: 126,039,860 S611T possibly damaging Het
Csn3 A G 5: 87,930,138 T168A unknown Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
D630003M21Rik T C 2: 158,204,802 T752A probably benign Het
Defb34 A T 8: 19,126,506 D71V probably damaging Het
Dync1h1 T A 12: 110,657,139 D3615E possibly damaging Het
Etl4 A T 2: 20,661,898 T167S probably damaging Het
F5 T A 1: 164,151,997 probably benign Het
Got1l1 C T 8: 27,198,485 M279I probably benign Het
Grm7 A G 6: 111,358,304 T559A possibly damaging Het
Ighv2-5 T C 12: 113,685,596 N79S possibly damaging Het
Igkv17-127 A G 6: 67,861,514 I70V possibly damaging Het
Itga8 T C 2: 12,182,736 S711G probably benign Het
Kndc1 A G 7: 139,910,286 T235A probably benign Het
Lct T C 1: 128,300,514 I1081V probably benign Het
Lrrc8b G T 5: 105,479,953 C55F probably damaging Het
Lrwd1 T C 5: 136,131,548 T311A probably benign Het
Mapk14 T C 17: 28,724,824 F129S probably damaging Het
Mdga2 A G 12: 66,716,722 I200T probably damaging Het
Mocos T A 18: 24,683,212 S615R probably damaging Het
Myh4 T C 11: 67,255,569 V1456A probably benign Het
Myh9 T C 15: 77,764,000 I1759V probably benign Het
Nat8f5 G A 6: 85,817,423 T185I possibly damaging Het
Nav3 T C 10: 109,694,082 I2133V possibly damaging Het
Ncam2 T A 16: 81,512,996 M458K probably benign Het
Nphp1 T C 2: 127,748,087 S532G probably benign Het
Olfr1184 T C 2: 88,487,365 V211A probably benign Het
Olfr649 C T 7: 104,189,391 R272H probably benign Het
Oplah A G 15: 76,297,955 L1035P probably damaging Het
Pask T A 1: 93,322,133 Q515L probably benign Het
Poglut1 A T 16: 38,549,416 F35I probably benign Het
Ppp1ca T G 19: 4,195,055 I319S probably benign Het
Psg25 T A 7: 18,529,608 R97* probably null Het
Sars2 T C 7: 28,742,284 probably null Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc16a7 T G 10: 125,233,439 probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
St6gal2 A T 17: 55,483,017 N351Y probably benign Het
Susd5 T C 9: 114,095,924 F292L probably benign Het
Tmco5 T A 2: 116,880,314 D38E probably damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Uncx A G 5: 139,546,767 I196V possibly damaging Het
Zeb1 G A 18: 5,759,007 C138Y probably damaging Het
Zfp609 A G 9: 65,703,695 I662T possibly damaging Het
Zfp985 G A 4: 147,583,563 C296Y probably damaging Het
Other mutations in Ifit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Ifit1 APN 19 34648133 missense possibly damaging 0.73
IGL01484:Ifit1 APN 19 34648843 missense probably damaging 0.99
IGL01505:Ifit1 APN 19 34648454 missense probably benign 0.38
IGL02663:Ifit1 APN 19 34640980 utr 5 prime probably benign
IGL03063:Ifit1 APN 19 34648004 missense possibly damaging 0.71
R0655:Ifit1 UTSW 19 34647647 missense probably damaging 1.00
R1524:Ifit1 UTSW 19 34647632 missense probably damaging 0.97
R1859:Ifit1 UTSW 19 34647544 missense probably benign 0.00
R3805:Ifit1 UTSW 19 34648156 missense probably damaging 0.99
R4714:Ifit1 UTSW 19 34648163 missense probably damaging 0.99
R5310:Ifit1 UTSW 19 34648804 missense probably benign
R5620:Ifit1 UTSW 19 34647838 missense probably damaging 1.00
R5787:Ifit1 UTSW 19 34647575 missense probably benign 0.29
R5964:Ifit1 UTSW 19 34648469 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- AAAAGGGCTCTGCTACAAGC -3'
(R):5'- AGCCACTTTCTCCAAAGCAGTC -3'

Sequencing Primer
(F):5'- AATCTCCCAACTGAGGACATC -3'
(R):5'- GTCAGTAGTTTCCTCCAAGCAAAGG -3'
Posted On2015-08-18