Incidental Mutation 'R4515:Orc4'
ID332829
Institutional Source Beutler Lab
Gene Symbol Orc4
Ensembl Gene ENSMUSG00000026761
Gene Nameorigin recognition complex, subunit 4
SynonymsmMmORC4, Orc4, Orc4l, Orc4P
MMRRC Submission 041589-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R4515 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location48902824-48950277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 48937489 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 31 (P31S)
Ref Sequence ENSEMBL: ENSMUSP00000088497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028098] [ENSMUST00000090976] [ENSMUST00000123271] [ENSMUST00000142851] [ENSMUST00000149679]
Predicted Effect probably benign
Transcript: ENSMUST00000028098
AA Change: P31S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028098
Gene: ENSMUSG00000026761
AA Change: P31S

DomainStartEndE-ValueType
AAA 57 199 2.75e-5 SMART
Pfam:ORC4_C 225 413 1.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090976
AA Change: P31S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000088497
Gene: ENSMUSG00000026761
AA Change: P31S

DomainStartEndE-ValueType
Pfam:AAA_16 34 138 3.3e-14 PFAM
Pfam:KAP_NTPase 38 123 2.9e-7 PFAM
Pfam:Arch_ATPase 43 130 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123271
AA Change: P31S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141441
Predicted Effect probably benign
Transcript: ENSMUST00000142851
AA Change: P31S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119274
Gene: ENSMUSG00000026761
AA Change: P31S

DomainStartEndE-ValueType
AAA 57 199 2.75e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149679
AA Change: P31S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121114
Gene: ENSMUSG00000026761
AA Change: P31S

DomainStartEndE-ValueType
SCOP:d1jbka_ 43 73 2e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153150
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154784
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunit protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. This gene encodes a subunit of the ORC complex. Several alternatively spliced transcript variants, some of which encode the same protein, have been reported for this gene. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik G T 5: 138,647,744 K630N probably damaging Het
Acss2 C A 2: 155,556,363 L335I probably benign Het
Alg6 A T 4: 99,752,786 probably benign Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Bsn G T 9: 108,104,078 probably null Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cdhr4 G A 9: 107,992,951 E52K probably benign Het
Ces1a T A 8: 93,020,904 N500Y probably damaging Het
Chd3 G T 11: 69,349,877 R1579S probably benign Het
Chrnb3 T C 8: 27,385,090 L39P probably damaging Het
Ckm A G 7: 19,420,284 K319E probably damaging Het
Cnot6 C T 11: 49,702,536 probably null Het
Copg1 A G 6: 87,907,546 probably benign Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnah2 A G 11: 69,465,631 S2135P possibly damaging Het
Dsg2 C A 18: 20,601,387 D807E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxi1 A G 11: 34,207,972 F18L probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gm11492 A G 11: 87,568,057 H419R probably benign Het
Gm9008 C T 6: 76,496,809 V275I probably benign Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Hemgn T C 4: 46,396,477 E253G probably damaging Het
Itsn1 G A 16: 91,899,649 V47M probably damaging Het
Kif5b A G 18: 6,208,257 V947A probably benign Het
Kif9 A G 9: 110,489,867 H133R probably benign Het
Lce1l T C 3: 92,850,474 T26A unknown Het
Macf1 T C 4: 123,493,988 E1172G probably damaging Het
Nkx3-2 C T 5: 41,763,938 V3M probably damaging Het
Nr2e1 G A 10: 42,578,191 T49I probably benign Het
Oc90 A G 15: 65,892,393 L138P probably damaging Het
Olfr834 T G 9: 18,987,982 probably null Het
Olfr954 C T 9: 39,462,231 R264* probably null Het
Paqr3 T A 5: 97,103,361 N168I possibly damaging Het
Pcdhac1 T A 18: 37,091,379 I415N probably damaging Het
Pdik1l T C 4: 134,278,896 N75S probably damaging Het
Pik3r4 A G 9: 105,672,725 H1005R probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Prkch A G 12: 73,702,838 T402A possibly damaging Het
Ptger4 C A 15: 5,242,379 R253L probably damaging Het
Rabac1 A T 7: 24,970,160 Y173* probably null Het
Rapsn G A 2: 91,043,212 V288M possibly damaging Het
Sec31a A G 5: 100,365,958 S993P probably damaging Het
Serpina9 T A 12: 104,001,294 M281L probably benign Het
Serpine1 G A 5: 137,069,468 A117V probably damaging Het
Sh3tc2 A G 18: 61,987,693 probably null Het
Sipa1l2 T C 8: 125,492,226 D124G probably benign Het
Slc6a12 T A 6: 121,353,530 probably null Het
Stk11 A G 10: 80,116,601 probably benign Het
Tcaf3 A G 6: 42,589,996 Y720H probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmprss11a C T 5: 86,420,196 R224K probably damaging Het
Tmprss15 C T 16: 78,957,356 S988N probably benign Het
Txn2 A T 15: 77,915,443 probably null Het
Ugt1a10 T A 1: 88,056,197 V239E probably damaging Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Vmn2r78 A T 7: 86,954,258 D548V probably damaging Het
Other mutations in Orc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Orc4 APN 2 48910269 missense probably benign
IGL01523:Orc4 APN 2 48917224 missense probably benign 0.00
IGL02546:Orc4 APN 2 48917284 missense probably null 0.02
IGL02592:Orc4 APN 2 48933078 critical splice donor site probably null
R0277:Orc4 UTSW 2 48937467 missense possibly damaging 0.78
R0323:Orc4 UTSW 2 48937467 missense possibly damaging 0.78
R0554:Orc4 UTSW 2 48905421 missense probably benign 0.01
R0573:Orc4 UTSW 2 48917273 missense probably benign 0.05
R0788:Orc4 UTSW 2 48937467 missense possibly damaging 0.78
R0893:Orc4 UTSW 2 48932610 unclassified probably benign
R1112:Orc4 UTSW 2 48933572 missense probably damaging 0.97
R1466:Orc4 UTSW 2 48909494 missense possibly damaging 0.91
R1466:Orc4 UTSW 2 48909494 missense possibly damaging 0.91
R1584:Orc4 UTSW 2 48909494 missense possibly damaging 0.91
R1868:Orc4 UTSW 2 48910293 missense probably benign 0.07
R2342:Orc4 UTSW 2 48927140 missense probably damaging 0.99
R2370:Orc4 UTSW 2 48933099 missense probably benign 0.01
R3085:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3086:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3122:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3404:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3551:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4199:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4518:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4519:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4521:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4523:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4529:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4532:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4533:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4652:Orc4 UTSW 2 48936750 unclassified probably benign
R4845:Orc4 UTSW 2 48909466 missense probably benign 0.07
R5893:Orc4 UTSW 2 48905547 nonsense probably null
R6708:Orc4 UTSW 2 48937493 missense probably benign 0.00
R6972:Orc4 UTSW 2 48927184 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGCTACCAGGTGTTAAGTACCAG -3'
(R):5'- TTCTGCCATTCACTGACGTG -3'

Sequencing Primer
(F):5'- CTACCAGGTGTTAAGTACCAGAATTC -3'
(R):5'- GACGTGACATCTCATTATTTACCTG -3'
Posted On2015-08-18