Incidental Mutation 'R4515:Atp8b3'
ID332868
Institutional Source Beutler Lab
Gene Symbol Atp8b3
Ensembl Gene ENSMUSG00000003341
Gene NameATPase, class I, type 8B, member 3
Synonyms1700042F02Rik, SAPLT, 1700056N23Rik
MMRRC Submission 041589-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R4515 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80519584-80539124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 80523847 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 984 (M984I)
Ref Sequence ENSEMBL: ENSMUSP00000020383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000220326]
Predicted Effect probably benign
Transcript: ENSMUST00000020383
AA Change: M984I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: M984I

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 20 97 9.3e-29 PFAM
Pfam:E1-E2_ATPase 121 367 2.2e-10 PFAM
Pfam:HAD 404 866 3.7e-17 PFAM
Pfam:Cation_ATPase 481 580 8.3e-12 PFAM
Pfam:PhoLip_ATPase_C 883 1135 4.2e-61 PFAM
low complexity region 1140 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220326
Meta Mutation Damage Score 0.1288 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik G T 5: 138,647,744 K630N probably damaging Het
Acss2 C A 2: 155,556,363 L335I probably benign Het
Alg6 A T 4: 99,752,786 probably benign Het
Bsn G T 9: 108,104,078 probably null Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cdhr4 G A 9: 107,992,951 E52K probably benign Het
Ces1a T A 8: 93,020,904 N500Y probably damaging Het
Chd3 G T 11: 69,349,877 R1579S probably benign Het
Chrnb3 T C 8: 27,385,090 L39P probably damaging Het
Ckm A G 7: 19,420,284 K319E probably damaging Het
Cnot6 C T 11: 49,702,536 probably null Het
Copg1 A G 6: 87,907,546 probably benign Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnah2 A G 11: 69,465,631 S2135P possibly damaging Het
Dsg2 C A 18: 20,601,387 D807E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxi1 A G 11: 34,207,972 F18L probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gm11492 A G 11: 87,568,057 H419R probably benign Het
Gm9008 C T 6: 76,496,809 V275I probably benign Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Hemgn T C 4: 46,396,477 E253G probably damaging Het
Itsn1 G A 16: 91,899,649 V47M probably damaging Het
Kif5b A G 18: 6,208,257 V947A probably benign Het
Kif9 A G 9: 110,489,867 H133R probably benign Het
Lce1l T C 3: 92,850,474 T26A unknown Het
Macf1 T C 4: 123,493,988 E1172G probably damaging Het
Nkx3-2 C T 5: 41,763,938 V3M probably damaging Het
Nr2e1 G A 10: 42,578,191 T49I probably benign Het
Oc90 A G 15: 65,892,393 L138P probably damaging Het
Olfr834 T G 9: 18,987,982 probably null Het
Olfr954 C T 9: 39,462,231 R264* probably null Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Paqr3 T A 5: 97,103,361 N168I possibly damaging Het
Pcdhac1 T A 18: 37,091,379 I415N probably damaging Het
Pdik1l T C 4: 134,278,896 N75S probably damaging Het
Pik3r4 A G 9: 105,672,725 H1005R probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Prkch A G 12: 73,702,838 T402A possibly damaging Het
Ptger4 C A 15: 5,242,379 R253L probably damaging Het
Rabac1 A T 7: 24,970,160 Y173* probably null Het
Rapsn G A 2: 91,043,212 V288M possibly damaging Het
Sec31a A G 5: 100,365,958 S993P probably damaging Het
Serpina9 T A 12: 104,001,294 M281L probably benign Het
Serpine1 G A 5: 137,069,468 A117V probably damaging Het
Sh3tc2 A G 18: 61,987,693 probably null Het
Sipa1l2 T C 8: 125,492,226 D124G probably benign Het
Slc6a12 T A 6: 121,353,530 probably null Het
Stk11 A G 10: 80,116,601 probably benign Het
Tcaf3 A G 6: 42,589,996 Y720H probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmprss11a C T 5: 86,420,196 R224K probably damaging Het
Tmprss15 C T 16: 78,957,356 S988N probably benign Het
Txn2 A T 15: 77,915,443 probably null Het
Ugt1a10 T A 1: 88,056,197 V239E probably damaging Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Vmn2r78 A T 7: 86,954,258 D548V probably damaging Het
Other mutations in Atp8b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Atp8b3 APN 10 80530987 missense probably damaging 1.00
IGL00484:Atp8b3 APN 10 80526164 splice site probably benign
IGL00904:Atp8b3 APN 10 80528764 missense probably damaging 1.00
IGL01326:Atp8b3 APN 10 80524376 missense probably damaging 0.98
IGL01368:Atp8b3 APN 10 80534229 splice site probably benign
IGL01448:Atp8b3 APN 10 80520422 missense probably benign 0.02
IGL01556:Atp8b3 APN 10 80530968 nonsense probably null
IGL01754:Atp8b3 APN 10 80530961 splice site probably null
IGL01809:Atp8b3 APN 10 80520011 missense probably benign 0.02
IGL01895:Atp8b3 APN 10 80521828 missense possibly damaging 0.80
IGL02184:Atp8b3 APN 10 80527233 splice site probably benign
IGL02224:Atp8b3 APN 10 80525976 splice site probably benign
IGL02377:Atp8b3 APN 10 80520294 missense probably benign 0.06
IGL02405:Atp8b3 APN 10 80530628 missense probably damaging 1.00
IGL03090:Atp8b3 APN 10 80530604 missense probably damaging 1.00
IGL03244:Atp8b3 APN 10 80534458 missense probably damaging 1.00
R0277:Atp8b3 UTSW 10 80526909 missense probably benign 0.21
R0908:Atp8b3 UTSW 10 80520084 missense probably benign 0.03
R0973:Atp8b3 UTSW 10 80534198 missense probably damaging 1.00
R1069:Atp8b3 UTSW 10 80531018 missense probably damaging 1.00
R1087:Atp8b3 UTSW 10 80520183 missense probably benign 0.00
R1553:Atp8b3 UTSW 10 80532542 missense probably damaging 1.00
R1603:Atp8b3 UTSW 10 80525785 missense probably benign 0.06
R1606:Atp8b3 UTSW 10 80532578 missense probably damaging 1.00
R1707:Atp8b3 UTSW 10 80521801 unclassified probably null
R1717:Atp8b3 UTSW 10 80528797 missense probably damaging 1.00
R1876:Atp8b3 UTSW 10 80530078 missense possibly damaging 0.70
R1939:Atp8b3 UTSW 10 80525386 nonsense probably null
R2138:Atp8b3 UTSW 10 80527105 missense possibly damaging 0.79
R2239:Atp8b3 UTSW 10 80530988 missense probably damaging 1.00
R2429:Atp8b3 UTSW 10 80526894 missense probably benign 0.02
R2696:Atp8b3 UTSW 10 80534183 missense possibly damaging 0.94
R2910:Atp8b3 UTSW 10 80519912 missense possibly damaging 0.90
R3424:Atp8b3 UTSW 10 80536347 missense probably benign 0.35
R3425:Atp8b3 UTSW 10 80536347 missense probably benign 0.35
R3432:Atp8b3 UTSW 10 80526180 missense probably benign 0.10
R3841:Atp8b3 UTSW 10 80529706 missense possibly damaging 0.95
R4518:Atp8b3 UTSW 10 80523847 missense probably benign
R4519:Atp8b3 UTSW 10 80523847 missense probably benign
R4619:Atp8b3 UTSW 10 80526024 missense possibly damaging 0.67
R4648:Atp8b3 UTSW 10 80525623 missense possibly damaging 0.94
R4709:Atp8b3 UTSW 10 80536770 unclassified probably null
R4774:Atp8b3 UTSW 10 80536322 missense probably damaging 1.00
R4796:Atp8b3 UTSW 10 80524354 missense probably damaging 1.00
R5000:Atp8b3 UTSW 10 80521842 missense possibly damaging 0.82
R5398:Atp8b3 UTSW 10 80529699 missense probably damaging 1.00
R5778:Atp8b3 UTSW 10 80520173 missense probably benign
R5990:Atp8b3 UTSW 10 80525697 missense possibly damaging 0.65
R6124:Atp8b3 UTSW 10 80529681 missense probably damaging 1.00
R6427:Atp8b3 UTSW 10 80520323 unclassified probably null
R6748:Atp8b3 UTSW 10 80525224 missense possibly damaging 0.56
R6756:Atp8b3 UTSW 10 80526061 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GGTGACTGACAGTAGGCTAGATATG -3'
(R):5'- GGGAACAAAGGCAGCTTCATC -3'

Sequencing Primer
(F):5'- GGCTAGATATGGCCACCAATAC -3'
(R):5'- GGCAGCTTCATCTCACATCTAAG -3'
Posted On2015-08-18