Incidental Mutation 'R4516:Olfr1229'
ID332896
Institutional Source Beutler Lab
Gene Symbol Olfr1229
Ensembl Gene ENSMUSG00000075095
Gene Nameolfactory receptor 1229
SynonymsMOR233-19, MOR233-22, GA_x6K02T2Q125-50727797-50726862
MMRRC Submission 041760-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4516 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89280476-89288014 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89282843 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 118 (M118L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099788] [ENSMUST00000213883] [ENSMUST00000214593]
Predicted Effect probably benign
Transcript: ENSMUST00000099788
AA Change: M97L

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000097376
Gene: ENSMUSG00000075095
AA Change: M97L

DomainStartEndE-ValueType
Pfam:7tm_1 39 286 2.9e-29 PFAM
Pfam:7tm_4 138 279 1.7e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111549
AA Change: M118L

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107174
Gene: ENSMUSG00000075095
AA Change: M118L

DomainStartEndE-ValueType
transmembrane domain 2 19 N/A INTRINSIC
Pfam:7tm_4 49 324 9.6e-51 PFAM
Pfam:7tm_1 60 307 7.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213883
AA Change: M97L

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000214593
AA Change: M97L

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.9%
Validation Efficiency 86% (51/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,517,200 probably benign Het
4930452B06Rik A T 14: 8,536,609 D199E probably damaging Het
4932438A13Rik T C 3: 36,895,311 S369P possibly damaging Het
Bean1 T C 8: 104,215,154 S211P probably damaging Het
Camta1 A G 4: 151,144,720 S552P possibly damaging Het
Cdh11 T C 8: 102,673,962 T125A possibly damaging Het
Cdk5rap2 A T 4: 70,276,715 probably null Het
Cenpc1 A G 5: 86,047,587 S108P possibly damaging Het
Cfap44 T A 16: 44,473,864 Y224* probably null Het
Cfap46 G A 7: 139,660,082 probably benign Het
Cntrl G A 2: 35,127,981 V468I probably benign Het
Col6a6 C T 9: 105,698,949 V2071I possibly damaging Het
Coq7 A T 7: 118,509,907 L306Q unknown Het
D7Ertd443e C G 7: 134,293,328 Q591H probably damaging Het
Dchs1 C T 7: 105,754,852 V2828M probably damaging Het
Dzank1 T A 2: 144,510,122 probably benign Het
Elmo1 C T 13: 20,282,914 T235I probably benign Het
Elp3 A T 14: 65,547,877 F492I possibly damaging Het
Espl1 A G 15: 102,323,236 S90G probably benign Het
Fbxl20 T C 11: 98,095,235 probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gm16286 G A 18: 80,211,576 M28I probably benign Het
Got1 T C 19: 43,504,841 Y243C probably damaging Het
Hipk1 G T 3: 103,750,372 H799N probably damaging Het
Kif21a A T 15: 90,971,142 M673K probably benign Het
Lama3 T A 18: 12,495,358 D1502E probably damaging Het
Limk1 A G 5: 134,676,786 probably benign Het
Myo5b A G 18: 74,625,674 Y242C probably damaging Het
Ncbp1 T C 4: 46,157,824 V354A probably damaging Het
Ncoa2 T C 1: 13,146,906 D1380G probably damaging Het
Ntng1 A G 3: 109,935,013 I148T probably damaging Het
Oas1d A T 5: 120,919,170 T280S probably damaging Het
Olfr389 C T 11: 73,777,040 G96S probably benign Het
Pax7 T G 4: 139,780,793 D307A probably benign Het
Pdxdc1 G A 16: 13,838,346 Q621* probably null Het
Rab29 A T 1: 131,867,731 Y27F possibly damaging Het
Rab3gap2 G A 1: 185,267,068 V991I probably benign Het
Ric1 A G 19: 29,570,765 T278A probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc47a1 T C 11: 61,344,513 H498R probably benign Het
Tas2r116 T C 6: 132,856,150 L238P probably damaging Het
Tigd5 A T 15: 75,910,515 R252* probably null Het
Tlr6 A G 5: 64,954,904 F220S possibly damaging Het
Tmem106b C T 6: 13,075,099 T95I probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn1r174 A G 7: 23,754,343 I145V probably benign Het
Vps26a T C 10: 62,468,345 M116V probably damaging Het
Other mutations in Olfr1229
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02982:Olfr1229 APN 2 89283109 missense probably damaging 0.98
R1535:Olfr1229 UTSW 2 89283057 missense probably benign 0.14
R1610:Olfr1229 UTSW 2 89282821 missense probably damaging 1.00
R3896:Olfr1229 UTSW 2 89283097 missense possibly damaging 0.78
R4922:Olfr1229 UTSW 2 89282467 missense possibly damaging 0.93
R4990:Olfr1229 UTSW 2 89283327 intron probably null
R5267:Olfr1229 UTSW 2 89282230 nonsense probably null
R5271:Olfr1229 UTSW 2 89282953 missense probably benign 0.39
R5514:Olfr1229 UTSW 2 89282473 missense probably damaging 1.00
R5621:Olfr1229 UTSW 2 89282353 missense probably damaging 0.97
R7154:Olfr1229 UTSW 2 89282860 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGTCCACAGAAAGGCAG -3'
(R):5'- TTGTCTACATTGCAACTATTGGGG -3'

Sequencing Primer
(F):5'- TGGATGATAGAGTGTAAGAATCCTCC -3'
(R):5'- CATTGCAACTATTGGGGGCAATATG -3'
Posted On2015-08-18