Incidental Mutation 'R4516:Hipk1'
ID332899
Institutional Source Beutler Lab
Gene Symbol Hipk1
Ensembl Gene ENSMUSG00000008730
Gene Namehomeodomain interacting protein kinase 1
Synonyms1110062K04Rik, Myak
MMRRC Submission 041760-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4516 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location103739815-103791563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 103750372 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 799 (H799N)
Ref Sequence ENSEMBL: ENSMUSP00000113998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029438] [ENSMUST00000106845] [ENSMUST00000106852] [ENSMUST00000118317] [ENSMUST00000137078]
Predicted Effect probably damaging
Transcript: ENSMUST00000029438
AA Change: H799N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029438
Gene: ENSMUSG00000008730
AA Change: H799N

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 679 695 N/A INTRINSIC
low complexity region 941 959 N/A INTRINSIC
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1095 1111 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106845
AA Change: H754N

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102458
Gene: ENSMUSG00000008730
AA Change: H754N

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 679 695 N/A INTRINSIC
low complexity region 896 914 N/A INTRINSIC
low complexity region 1002 1018 N/A INTRINSIC
low complexity region 1050 1066 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106852
Predicted Effect probably damaging
Transcript: ENSMUST00000118317
AA Change: H799N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113998
Gene: ENSMUSG00000008730
AA Change: H799N

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 679 695 N/A INTRINSIC
low complexity region 941 959 N/A INTRINSIC
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1095 1111 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135634
Predicted Effect probably benign
Transcript: ENSMUST00000137078
SMART Domains Protein: ENSMUSP00000120396
Gene: ENSMUSG00000008730

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 672 695 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200071
Meta Mutation Damage Score 0.312 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.9%
Validation Efficiency 86% (51/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Ser/Thr family of protein kinases and HIPK subfamily. It phosphorylates homeodomain transcription factors and may also function as a co-repressor for homeodomain transcription factors. Alternative splicing results in four transcript variants encoding four distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile, do not develop spontaneous tumors, and are resistant to DMBA-induced skin tumor formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,517,200 probably benign Het
4930452B06Rik A T 14: 8,536,609 D199E probably damaging Het
4932438A13Rik T C 3: 36,895,311 S369P possibly damaging Het
Bean1 T C 8: 104,215,154 S211P probably damaging Het
Camta1 A G 4: 151,144,720 S552P possibly damaging Het
Cdh11 T C 8: 102,673,962 T125A possibly damaging Het
Cdk5rap2 A T 4: 70,276,715 probably null Het
Cenpc1 A G 5: 86,047,587 S108P possibly damaging Het
Cfap44 T A 16: 44,473,864 Y224* probably null Het
Cfap46 G A 7: 139,660,082 probably benign Het
Cntrl G A 2: 35,127,981 V468I probably benign Het
Col6a6 C T 9: 105,698,949 V2071I possibly damaging Het
Coq7 A T 7: 118,509,907 L306Q unknown Het
D7Ertd443e C G 7: 134,293,328 Q591H probably damaging Het
Dchs1 C T 7: 105,754,852 V2828M probably damaging Het
Dzank1 T A 2: 144,510,122 probably benign Het
Elmo1 C T 13: 20,282,914 T235I probably benign Het
Elp3 A T 14: 65,547,877 F492I possibly damaging Het
Espl1 A G 15: 102,323,236 S90G probably benign Het
Fbxl20 T C 11: 98,095,235 probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gm16286 G A 18: 80,211,576 M28I probably benign Het
Got1 T C 19: 43,504,841 Y243C probably damaging Het
Kif21a A T 15: 90,971,142 M673K probably benign Het
Lama3 T A 18: 12,495,358 D1502E probably damaging Het
Limk1 A G 5: 134,676,786 probably benign Het
Myo5b A G 18: 74,625,674 Y242C probably damaging Het
Ncbp1 T C 4: 46,157,824 V354A probably damaging Het
Ncoa2 T C 1: 13,146,906 D1380G probably damaging Het
Ntng1 A G 3: 109,935,013 I148T probably damaging Het
Oas1d A T 5: 120,919,170 T280S probably damaging Het
Olfr1229 T A 2: 89,282,843 M118L probably benign Het
Olfr389 C T 11: 73,777,040 G96S probably benign Het
Pax7 T G 4: 139,780,793 D307A probably benign Het
Pdxdc1 G A 16: 13,838,346 Q621* probably null Het
Rab29 A T 1: 131,867,731 Y27F possibly damaging Het
Rab3gap2 G A 1: 185,267,068 V991I probably benign Het
Ric1 A G 19: 29,570,765 T278A probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc47a1 T C 11: 61,344,513 H498R probably benign Het
Tas2r116 T C 6: 132,856,150 L238P probably damaging Het
Tigd5 A T 15: 75,910,515 R252* probably null Het
Tlr6 A G 5: 64,954,904 F220S possibly damaging Het
Tmem106b C T 6: 13,075,099 T95I probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn1r174 A G 7: 23,754,343 I145V probably benign Het
Vps26a T C 10: 62,468,345 M116V probably damaging Het
Other mutations in Hipk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Hipk1 APN 3 103778160 missense possibly damaging 0.49
IGL01024:Hipk1 APN 3 103760636 missense probably benign 0.31
IGL01069:Hipk1 APN 3 103777699 missense possibly damaging 0.95
IGL01798:Hipk1 APN 3 103761559 missense probably damaging 0.99
IGL01937:Hipk1 APN 3 103744004 missense possibly damaging 0.71
IGL01945:Hipk1 APN 3 103744004 missense possibly damaging 0.71
IGL02184:Hipk1 APN 3 103758750 missense possibly damaging 0.96
IGL02430:Hipk1 APN 3 103760655 missense probably damaging 1.00
IGL02603:Hipk1 APN 3 103750272 missense probably damaging 0.97
IGL02632:Hipk1 APN 3 103760545 missense probably benign 0.14
IGL02686:Hipk1 APN 3 103778017 missense possibly damaging 0.82
IGL03293:Hipk1 APN 3 103777259 missense possibly damaging 0.83
effluvient UTSW 3 103754325 splice site probably null
R0012:Hipk1 UTSW 3 103763680 missense probably damaging 0.98
R0012:Hipk1 UTSW 3 103763680 missense probably damaging 0.98
R0512:Hipk1 UTSW 3 103760574 missense possibly damaging 0.95
R0741:Hipk1 UTSW 3 103746812 missense probably benign 0.17
R0785:Hipk1 UTSW 3 103754325 splice site probably null
R0786:Hipk1 UTSW 3 103744304 missense probably benign
R0833:Hipk1 UTSW 3 103754296 missense probably damaging 0.98
R0836:Hipk1 UTSW 3 103754296 missense probably damaging 0.98
R1165:Hipk1 UTSW 3 103761524 missense possibly damaging 0.62
R1322:Hipk1 UTSW 3 103743981 missense probably damaging 1.00
R1384:Hipk1 UTSW 3 103758774 splice site probably benign
R1521:Hipk1 UTSW 3 103777782 missense probably benign 0.16
R1543:Hipk1 UTSW 3 103778164 missense probably benign 0.00
R2085:Hipk1 UTSW 3 103750354 missense probably benign 0.00
R2158:Hipk1 UTSW 3 103760538 missense probably damaging 1.00
R2291:Hipk1 UTSW 3 103761610 missense probably damaging 1.00
R3522:Hipk1 UTSW 3 103744114 missense probably damaging 0.96
R4518:Hipk1 UTSW 3 103750372 missense probably damaging 0.98
R4884:Hipk1 UTSW 3 103744022 missense possibly damaging 0.47
R5023:Hipk1 UTSW 3 103777507 missense probably damaging 1.00
R6045:Hipk1 UTSW 3 103746902 missense probably benign 0.45
R6641:Hipk1 UTSW 3 103753405 missense probably damaging 0.99
R6904:Hipk1 UTSW 3 103777512 missense possibly damaging 0.90
R6925:Hipk1 UTSW 3 103778245 missense unknown
R7169:Hipk1 UTSW 3 103744217 missense probably benign
R7212:Hipk1 UTSW 3 103777610 nonsense probably null
R7313:Hipk1 UTSW 3 103778258 missense unknown
Z1088:Hipk1 UTSW 3 103764544 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCCATGTTAAGCGCAGGACC -3'
(R):5'- ACTTCATATGTAAACAGGCCTTACC -3'

Sequencing Primer
(F):5'- GCAGGACCTAACATAGACTTACTTGG -3'
(R):5'- CTTACCTGATTGGAAAGGACACAGTG -3'
Posted On2015-08-18