Incidental Mutation 'R4516:1110017D15Rik'
ID332901
Institutional Source Beutler Lab
Gene Symbol 1110017D15Rik
Ensembl Gene ENSMUSG00000028441
Gene NameRIKEN cDNA 1110017D15 gene
SynonymsSmrp1, Cbe1
MMRRC Submission 041760-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R4516 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location41505009-41517333 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 41517200 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030152] [ENSMUST00000095126] [ENSMUST00000108049] [ENSMUST00000108050] [ENSMUST00000108052]
Predicted Effect probably benign
Transcript: ENSMUST00000030152
SMART Domains Protein: ENSMUSP00000030152
Gene: ENSMUSG00000028441

DomainStartEndE-ValueType
Pfam:SMRP1 1 260 3.3e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095126
SMART Domains Protein: ENSMUSP00000092744
Gene: ENSMUSG00000028441

DomainStartEndE-ValueType
Pfam:SMRP1 1 202 6.5e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108049
SMART Domains Protein: ENSMUSP00000103684
Gene: ENSMUSG00000028439

DomainStartEndE-ValueType
Pfam:FAM219A 26 157 2.7e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108050
SMART Domains Protein: ENSMUSP00000103685
Gene: ENSMUSG00000028439

DomainStartEndE-ValueType
Pfam:FAM219A 26 156 8.9e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108052
SMART Domains Protein: ENSMUSP00000103687
Gene: ENSMUSG00000028439

DomainStartEndE-ValueType
Pfam:FAM219A 37 168 1.6e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151164
Meta Mutation Damage Score 0.0668 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.9%
Validation Efficiency 86% (51/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear- or perinuclear-localized protein with no predicted domains or similarity to other known proteins. Expression of this gene is induced during the differentiation of bronchial epithelial cells, and the encoded protein may play a role in ciliogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A T 14: 8,536,609 D199E probably damaging Het
4932438A13Rik T C 3: 36,895,311 S369P possibly damaging Het
Bean1 T C 8: 104,215,154 S211P probably damaging Het
Camta1 A G 4: 151,144,720 S552P possibly damaging Het
Cdh11 T C 8: 102,673,962 T125A possibly damaging Het
Cdk5rap2 A T 4: 70,276,715 probably null Het
Cenpc1 A G 5: 86,047,587 S108P possibly damaging Het
Cfap44 T A 16: 44,473,864 Y224* probably null Het
Cfap46 G A 7: 139,660,082 probably benign Het
Cntrl G A 2: 35,127,981 V468I probably benign Het
Col6a6 C T 9: 105,698,949 V2071I possibly damaging Het
Coq7 A T 7: 118,509,907 L306Q unknown Het
D7Ertd443e C G 7: 134,293,328 Q591H probably damaging Het
Dchs1 C T 7: 105,754,852 V2828M probably damaging Het
Dzank1 T A 2: 144,510,122 probably benign Het
Elmo1 C T 13: 20,282,914 T235I probably benign Het
Elp3 A T 14: 65,547,877 F492I possibly damaging Het
Espl1 A G 15: 102,323,236 S90G probably benign Het
Fbxl20 T C 11: 98,095,235 probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gm16286 G A 18: 80,211,576 M28I probably benign Het
Got1 T C 19: 43,504,841 Y243C probably damaging Het
Hipk1 G T 3: 103,750,372 H799N probably damaging Het
Kif21a A T 15: 90,971,142 M673K probably benign Het
Lama3 T A 18: 12,495,358 D1502E probably damaging Het
Limk1 A G 5: 134,676,786 probably benign Het
Myo5b A G 18: 74,625,674 Y242C probably damaging Het
Ncbp1 T C 4: 46,157,824 V354A probably damaging Het
Ncoa2 T C 1: 13,146,906 D1380G probably damaging Het
Ntng1 A G 3: 109,935,013 I148T probably damaging Het
Oas1d A T 5: 120,919,170 T280S probably damaging Het
Olfr1229 T A 2: 89,282,843 M118L probably benign Het
Olfr389 C T 11: 73,777,040 G96S probably benign Het
Pax7 T G 4: 139,780,793 D307A probably benign Het
Pdxdc1 G A 16: 13,838,346 Q621* probably null Het
Rab29 A T 1: 131,867,731 Y27F possibly damaging Het
Rab3gap2 G A 1: 185,267,068 V991I probably benign Het
Ric1 A G 19: 29,570,765 T278A probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc47a1 T C 11: 61,344,513 H498R probably benign Het
Tas2r116 T C 6: 132,856,150 L238P probably damaging Het
Tigd5 A T 15: 75,910,515 R252* probably null Het
Tlr6 A G 5: 64,954,904 F220S possibly damaging Het
Tmem106b C T 6: 13,075,099 T95I probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn1r174 A G 7: 23,754,343 I145V probably benign Het
Vps26a T C 10: 62,468,345 M116V probably damaging Het
Other mutations in 1110017D15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:1110017D15Rik APN 4 41507178 missense probably damaging 1.00
IGL01062:1110017D15Rik APN 4 41511433 missense probably damaging 1.00
IGL02645:1110017D15Rik APN 4 41517080 missense probably damaging 1.00
IGL03124:1110017D15Rik APN 4 41507287 missense possibly damaging 0.87
R0284:1110017D15Rik UTSW 4 41507538 missense probably damaging 1.00
R1760:1110017D15Rik UTSW 4 41507330 critical splice acceptor site probably null
R1761:1110017D15Rik UTSW 4 41507223 missense probably damaging 1.00
R2073:1110017D15Rik UTSW 4 41507519 critical splice donor site probably null
R2180:1110017D15Rik UTSW 4 41507170 missense probably benign 0.00
R4414:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4415:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4416:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4417:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R5132:1110017D15Rik UTSW 4 41517178 unclassified probably benign
R6132:1110017D15Rik UTSW 4 41517160 start codon destroyed probably null 0.98
R6413:1110017D15Rik UTSW 4 41505135 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CTGGGGTCACAAACTTGTTG -3'
(R):5'- AATTAGGCCTTCTGTGCAGG -3'

Sequencing Primer
(F):5'- ACAAACTTGTTGGCTTCCCAGG -3'
(R):5'- CAGGTGATATCATAATGGGCATTGC -3'
Posted On2015-08-18